Vienna Tile Information
VT ID VT027231
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205530
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 227231
Nearest Genes
Gene Nr FlyBase ID Distance
CG7391 FBgn0023076 3511 bp
Sequence Length 2114
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AACGAATGATTGAGTGTGGGTACTAAATGTCT
Right Primer TCCACAACAATGTGGTCAATGCCAA
Template genomic
Sequence AACGAATGAT TGAGTGTGGG TACTAAATGT CTAGTGAATT TACCTTTTTG TATCATCCTT GTCGTCGCTC TCGTCGTCCA TTTTCGGGTC TGTAGGATAG TCCACTACAA GGCGCACAAT TTTTAAACAA ATGCCGAAAA AAAAATGGGA AAAGGGGCAA ACGAGAAGAA CCGAAGAAAG TTCGAAACTT CCACTTCTTT TGAAGATTTG CTCACAAATG CCACAAATTA GTTACACGCT CACATAATTT TGTTCATATG TGCTCTTGTC TTTGGTTTAA AGTTCAGGTA ATGTTCACGC AACAATTGAT TTCCATATGC TCAATATGCC ACATTTTGAA TAACTGCAAA GGGTTGGGGT TAGCGTAATT GATTATATTC CGTGATTTTT TTTTTTAAAG TTTTTCCTCT TTATTTTTCC CGACGCGTTT TTTATTCCGA AAGCTATCGT CAAACGCCGC GCTGTGCCAG CAACAAGTGC AGTTGTGGTT CTGTTTCGGT TTCGTTTTCG CCAAGTGCCA GCATCCTTTT CCGAATCGGT TATCGCCAGG TTATGTAATT GAATAAGCTG CGCCTGCGCA GGCTCCCCAT TTGGAGGCCC CGTGGCCAAT TTGCCAGTTA GCCGTGCCAA TCAATGTTGC ACATTTGCAA CCCCTGAAAT GTATGCTACG CTATTTTGTC ATGTTACAAA ATGCGTTCAC TGAATGCCAT AACAACCACT GCTCGGTGGT TGGAGGAAGG TGGTTGCACG GAATGGGTGG GTTTGCTTAA TCGAGGAGTG TGAGTGGGGC AGCTGCCAGC CAATTGCCTG GCTGCAGCGG GAATTTGAGT GCGGATGCTG GGTCTGTTTT TCAGCTAAAA ATAAGCTGAC ATACACGCTT GCGATTGCAT AAGGCTCCGC ATTTGCCTGA CTGTCTATTG ATTTCTTTTT GAATTCCACG CTTTTCAATC ATTTCCTGCA CCTTAAGCCA TCCTCCTTAA CACACGCAAA ATTATTCACT GTTAATTGAC GGTCCAGCAT TTAAGGGGCT TCGGCGAAAA GCAATTTCTT GCCTAACAAC AACTTGAAAA GTTTTCAGCA AATGTCAAAG GTTCTGCAAG CCTGTTAAAT GCATTCGACC AGTTGGATGG GGTTAAGACT GGATTTCCTG CAAGTCGGTG ACGTTCAAGC TGGAACTCAT TTAAAGTTGG CGCATTGACG AAAAATCTGT GTTTAATTAA AATGTGCAAA GCAGCTTAAA ATTACCCAGC TCTACATCTG TCGTGCCAGT TGTAAATAAT CCGTTTACCT CCGTTTGACC AATGGACCCA AAGCGCAGCT CATAATTTCC CACATGCCTA CATGTATGGG TTGGAGAGCA TTTTAAATAC ACATCAAAGG CCGAAAAGCG TCCCGTTCCT TTTTGGCCAA GTGTTGCTGG TTAACCGTAA GTAGCTGTTG GCCCAGACCC AGACTTCAAA TGCTGCCAGA TAATTGCCAA TGACTCGCTT AATGGTTCGT GTTGCAATTA GTGCGGTCGG TTTGGTTTGT CGCAAAGTGC AAAAAAGCAG TCGAGATAAG GTTTAAGATG GAGACATATA GAGAGGGTGT CAGGTATTAT TATTCAGTAA GCTAGCTTTG CCCCGAGGAA TGTGGTCCAA TTACAACTCA ATTATAAACT CTGGAATTAT TGGGTTAAAA AAAAAAAATA TACGTTGCCT CAATACAGCT TAAATAATCT TTAAGACGTT TACAAAAAGT CCAAACTGCC TAAAATGTTT ATAAACCTCA AGTCGAAAGA TCAATCAATC ACTTTCTAAA ATGAAGACTT CATTAATCTC AATCCAATAT GATTGTGATC TAAAGTTGCT GAGTTAGTTA CTCCTCTTAA AAATCATTAG TGACTTTTAA ATAGTTTTGA AGTTTGTTAC TTATGAAAAT GTAAGTACAA TACCTTTCGT TCACCTTAGC TTTTCCAATC TCTTTTAGCC TTCACCCCAG TGAATTGAAC TGCACTAAAC AGCTTTAAAA CCAACATCAA ATTCTACACA GTATGTGATA TAGAGTATAA GCATCATCTA TTACAAATAG TATCTGATGT ATCAAACAAT TGGCATTGAC CACATTGTTG TGGA