Vienna Tile Information
VT ID VT054914
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205505
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 254914
Nearest Genes
Gene Nr FlyBase ID Distance
CG13366 FBgn0025633 16772 bp
Sequence Length 2098
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer TGCGAAGAGTTGGATACGAAAGGGA
Right Primer GGTCGAACTTACAGAAGTGGAGTGGG
Template genomic
Sequence TGCGAAGAGT TGGATACGAA AGGGAAAGCA TTTTCCCATA ACTGTCCTTT GTGCTTCCAC CTCCTGGCAG GACTCGTGCC CACAGGCCAA ATGCAATGTT AATGACCAAA CTCTCCGGCG AACACAATGT CCTGATCCCG CCGTGAAAAA TGGGGTTTAC AAAGTTGCGG GGCGCTGCTG TAATTAGCCA ATGCGGGGCC GTAAATCGGT GGAGGGGTGG GAAAAGCGGT GGGTGGGAGG CGATGGAAGA CTGGTGGGGG AAGGCAAATC AAATTAAGGC GCAAGTTGAT GCCGCATTTT ACAGTCCTGT CTCTTCGGGG TGGCGGATGG AGTCTGACGG TTTTAATAAT GTTGTTGCTC ATTTCGCGAC CAGCGTCATT ATCAGCATGT AATTTCTCAT TTTCATAGTC AATTAAGTCA ATCACTCGCC CTTTTGGCCA CCGCAAGGCC TTGCAGAGCT GAAAGCTGAA AACTGAATAC TGAAGGCCAG CCCATAGCAT GGAAAGCCAC CCCTGTTAAC ACGTTGGCGG TGGCGTGTTT CCGTTTCCGC TTTCCACACC TTTTGTTTAT TTGTAACGCA ATTTAAAAGC GCCGCGCCGC GCCGCGCGTT TATTGCTCAA TTTTGAAAAG AGAAAAGGGC ATTAGGTATT CATACACAAT CACCGGACTC ATCGATGAGC GATGGAGGAT GACTGGATAG ATTCGGCGGG CTCGGAAAAA TATACACCCA CCCTCAAGGC AATAACTGTA ACAATTTCAA GCACTAAAAC GACACGTGGC AGCTGCTTTT AAAATTGAAT TTCCTGTCAT GTAATCTTGT CCAGAGTCAA TTGTTTTTGT ATTTCTGTGT GTGGGTTTTG CAACACCCCC TTGTTTTTCC GCCCGCACGT GCCGCATTGT GTTTTCCTTG TGTGTTTTCG AAAGGTACCC CCTCGTAGTT TGGGGTGCGT CGCGGTCACA CTTTCTTATT TATGAAGATG CGGCCAATAT GCTGACGATT TGCTGACCCA CTAATACCAA AAGTATACTT TATGGGTGTG AATGAGGTTT TATGCATTCA CAGATTGACT TTCTAATGGG GTGTGAAAAG CCGGGGTGGG CAATCGGAAA ACACGGCGGA TACGGCGGGA TAACAAGGAT CAGCAGGTTT CTGTGGGATC TGAAATGCGT AATTAATCGG GGGAGATTAG GCCGAGAAAA AATTAATAGA GGATGGAAGG TAATTGAAAA TGTAACATCA AGACTTGATT GGTAAGTAAG TCTTACATGA CAGACGTACG TATAATAACT TAAAACAAAG TAATTCAACG GAGTTTACTG CTACTACAAC TTTTTATAAA GAAGGAAGTA TCTATCTTAC TTGGCCCTCT AGCTTAGTCA TCACCGTTTT TGCGCGTTTC CCATCGACTC GATGTTCACA TGCCTAATTA GCATGTCAAT AAGTCGAAAA GGAACCAGAA ATGATTTTAC CCCTAATGAA AGCATTAAGG ACAGATCGAG GGGAGTTGCA TGTGTATTCG CGGAGCGTGC GCCATTAAAA GGCCACGAAC ATCAATTTAT ATATTGCGTT ACCATGATTT GCATAAAGGG CACACGCATA TCTCATAATA AATACATATA CTCCCCCTCA GCCGCGAAAT CACGGACAAA ACAAAGAGAA ACCCCATTAA ACCAATATAA ATTTGCACTC TCTCATGACC TCGGCGAGTG TCCCTTTCAT ACTCTGTTTG TGTATCCTGG TGGTTGCTGC AGTGTCGATC GACTAATTTG AATATAAATG CGCCAAGCGC CGGTGTTCCT AGCACCTCCT TCCCACGACA TCGATACGAT ACGATACGAT ACGATACGAT ACGATCCATT GCCATTAGCA GACAAAAGAA CAGCTCCTGT ATACGGACAC TGGGAGAAAA GATGTTAGCG AATTTTTAAA TGCAATGATA AAATAGCTAT TAAGCATGAA TACAACTGTC TGCATTGTCG AAGATAATCG AATGTAAAAT ACCTGGGAAG TAAATAGAAT CGGCGCATTA AACTTAAAAA CATTTTCGCT GTGTGGGAAA GTCGACGGCG AACCCACTCC ACTTCTGTAA GTTCGACC