Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT055791
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205498
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 255791
Nearest Genes
Gene Nr FlyBase ID Distance
CG7952 FBgn0001150 1888 bp
CG7925 FBgn0003714 11028 bp
Sequence Length 2100
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGCCGAAGTCGAAGCCAAAGAGTT
Right Primer ACGGACACACCCCTCTATCCCCTGT
Template genomic
Sequence GGCCGAAGTC GAAGCCAAAG AGTTGCCAAG TTCGGTGTAA AAACCAGATT CAGCGAAAAA AAAACGTAAA AAACAGCAGG CCATAAAACC ATATATTCAT ATACTCGGAC TGCTGTTCCT TCGCCATAAT GAGCTCCGAA CCAAAGATGC AATATTTGTG CAATCCTTTG AGTTGTGACC TTGGGCGCGT TTTTTACGGA ATCATCTACC TGATGGCCGA ACGGGTTGCC CACCCACGGT ATGCGCTGTA TTAGGCTGTT ATGCTGTTGC CTAAAAAACA TCCAAAGTTT TATTGCATAA TGGACGCTTC GTGCGAAAAG GCCTCATTCC GAGTCCGCGG GCCCTAAAAC CGCTGCAGTT TTTTAAGGAG CCATAAACTG ATATTTCGGA CACCGGCGGT CCTTAAAAAA AAAAGGGTTC TCTCCTCCGA CCATTGTGGC TGCGATTTTT ATATTGGTCC GCTGCTAGGT GACAAAGAAA ATCAGCGACT AATTGACTGA AAGGGGTTTT GCCTTATATG ACCCGTCCCA CCCGTCCAAA AAAGGGTGAG GAGTGGTTTG GATTTGGATT CGTGCTTGGT TTCGGGGAAT TGCCGTTAAC TCCTTTCGCG GCCCTTTGTC TTAATGGGTT AACAGTCGCA TATTGGAATC CTTAGCTTCG AATGGCCCCT GTCGTAAACG TAAGTTGAAA GCAACTTATC ACATATTAGG ACTGCCATTT TGTTTCTGAG AATCTGTATT CCCGCTTTTT ACCCCTAAAA AACCCCTAGT TTGGGATAAG CAAAGATCAG CGCTCTCCTC CGCACTTTCA TCTCGAAGTG ATGGTAAGTT TCTGGTAATA AATTATCTTT TTCATATCAT CAATTCTTGC AAGATAATGC CAACTTCCTC CCAAAGGAAC TCCTTGAAAG GCCGTTCTTC AGCACAATTG ATGAAATGAG ATTACTTTCA AATGTATGAT TAGTTTGGCC GTCATTCAGT TGATTCTCGG CCACGATGGC CGTCTAAGCC CATCAGGAAA GGCACCTATA TCCTGCGATG CTAATGAGGA AGTAAGTAGT CGGCCGGCGA GGAAGTGAAC GGGGATTACA CGTGCTCCTC GGCCGGACAA AGGCACTCTC CTCTCGCAGC AGAGTGTTTG GGCTAAGCGA AAAAGACTAA CCAGGATCGA GAGTCGGAAA TCGAGAATCG AGGACTTGGG ATCACTTGTT TGTTTTCCTT GGCATATGCA AAGTGCACAC TTGCAGAGGA TAATGGGAAC AGGTATTGCT CGGCTCGATG TGTCTGGGGA TTTGCCTTAG CCACTTCCGC AAACGGAAGT GCACAGCTCG GCAAAAAGAA CCCCGACTAA AAAAAGACAC AAGTTAAGTA CTCGAAGGGA ACCCACAATG GCCATAGCTT CCGTCGTCAA ATCCTTTGGC TAATTGTTAT CCTATGGCTC CTAATCCCAC GTCCAGCAAA AGGCTGCTCA ATTATGGCAT CTCTTTAATT GAGAGACGTC GAGCCGCTTC GAATAGAGCC TTACTTCATT CACCGCTGAC CAGCCAAGCG AAAAGATCTC GAGCAGATCT CAAGTCCGGA ATATGAAATC CGGATCCCAA ATTCAAAAGC AGTATTGCAT TACTATGCCA ATTAGTGCGG TTTTGATTAC CCAAATGACA TTGGCCTTGC AGACCCGCAA TTCTTTGGAG TCCTCTTATC TGCCGAGCAA GTTGCATCTT CCAAATTGGG GCGACATCGC GTCTATCGTA TTACTATCTT AAGTTTGCAC CGGCCAAACA TCCCAGCAAC TCAATGAACT TTGAATGATC GAGTGCGTGG AGCTGCGAAT GCCAAATATT GAAATTGTGC GCGATAAGTT CAAGGTTCTG ACTCAAGATT GGGTCGATCG ATTGATCGAT GGGGGGACCC CACACGGAAA AAGTGTCATT TAATGCTCGT CAAATCGACG CACAAAGAGC TCGGTGTCCA GAGTGCAATT TAAATGGGCA AAACTAACTT GCTACTTCCT TACGCCATCA TTGTGCCTGT TGTCCCGTTG TCCCGTTGTC AGGACCCCAG GAAGATGGCC AGGATACAGG GGATAGAGGG GTGTGTCCGT