Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT030530
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205447
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 230530
Nearest Genes
Gene Nr FlyBase ID Distance
CG32139 FBgn0042630 9079 bp
Sequence Length 2254
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCCTCCCGAAACTCCATACTCCCAC
Right Primer TGGTCCGAGTGCGACAGAAAGAGAC
Template genomic
Sequence GCCTCCCGAA ACTCCATACT CCCACTCCCC ATCCCATCTA CACCCACTCA TAATGGTAAA ATACTAATTT ATAGATACAT TGACAGTGCC AAGGGCCCAA CTGGCCATCA AATGAGCAAC TCTCCTTCTG GGGACGACAC CTTCGAGAGA ATGGATTGTC TGGGGGCTGT GGATGTGGAT GTGAAGGTGG GAAGAGAGGT GGTGCAAAGG CGCCCTGGAC ATAATAATAA ACAAGACCAG CAGCCGGTGG ACATAGATGG GGGCATACTT GTAGATACAA GTTGAGCAGT TGAATAAACT AGACCCACAA AAGGATGACA ATGACAATGT CTATGTTTGC CCAATGTCTA TGATGTTGGC GCCCCTTGGC CAAACAGAGC ACTCCGGCAC TTCAGCACTC TAGCACTGCA AGGCAGTCCG AGAATTTTCT CCTCACCGGC TGGCTGACCA GCTTAATAAT TGATACGAAA AACAAGCCAG CAGTTGGCAG TTGCGAGATA TTTCCGAGAC TCTTTCTGTT ACAATTAACA AGTTTTTCCG GCCTGGAAAC GTTGCACGTT TCGTTCGCCT AACCCACAGA TCAAATATTT GACCATCACC AGTTGCAGTT TCCAGTTTTT GTGGATTCTT CGTTTTGGGG TCTGCAGTTA CACTTTCCAC TCACCCGGAC AATCGGGCTA CTTATGGGAT TACTTAGCTT CTCTTCTGCT GGTGGGTTAT ATTTGGGGGC CCCACTCATA ACGCGACCAC CGATTAACTT GTTTGCCCAG CAATTTAATG GCTTTAGTTG GAGCGTTGGG AGTTTTCTCC ATTTTCTTTG CCCTCCGTTT GGCCACTCGA AATCTGGCTT ATTTGCTCAT TCTTTGTTGC GGGAATCGTG AGAATAAGTC CTAAGTTCTG ACGGGACTAC TTATGAGTAA GAAAAAAACT TCTCACACTG GGACCTATAC GATATATTGT TTTTCAAAGC TGGTTAGGTC TGAATATCGA AGTTAGGCAT AGTTATTTAA TAATTTAGAA ATTTATTGAC AGCAGCGCCC TTAATTTGTC CAGGGATACT CTTCAAATAA AATTTGAAGA CAGTGCATTG TGTCTGCAGA CATGTGTGAT ATAATTTTCG AAAGAATACA TATTGATCAC CCAAACCTAT TAACAACTTT GAATCTCTGT ATTCTTGTAA TATCAGTTTC GAATGTATTA AAACAACTAA AAACTTAAAA TAGGTCTCGC TATGGTGAAA TTCGTAGCAT ACTTAAAAGG GGTTTAACAA ATCTTCATCT AAATAAAGAT AATGTCCATT GTAAAATTAT GTTAGTGAAG GGTAGATCCA GTAGGTTGAC TAAGGTGATC CAGAAAGTAC TAAGCAATTT TCCGCGGTAT TGTCATATGA TACACCCCTT ACCTAACGAG TAAGCTTTGT TTACAATTTC TTAAAATCTC CGTGAATTTT TTGTTTCCGC CCATTAAACA CTCGTTTCCC ACCTGTCAGA TGCAACTGGC AGGCAGCGTC GTAACCTTCA CGCCCACCCA ACGGCCTCCC GCCCACGTAA ACGCCTCCTC GAAAGCTTTT TCCAATTGCA AACTAATCAA TTGTTCGCAT TTTATTAAGC AACAAAAGGT GATCGTGGGG GTGGGAAAAG GCTTGAGTTC GACCTTTTGT GATTGTTTGC TTTTTTCCTG TGCCTGTTCC TGCTCCTTGG ACCTTTTGTT CCGCCGGGTC CAACGGCTCA TTCATCCAAC TCTCCTCAGC TTTGTCTGCC ATTATTAAAT ATTCCCGGTG GAGTGGCAGG AGCTTTGATT AAAAATAAAG AACATTGGCG AATCGACAGG TTTTTCAATT ATTTGCGAAT ATACAAAACA CGATAGGAAA GACTTTTCCA CGAAAGGCAT GAGCGGTGTT GTTGTTGCTG CTGTCGCCTT TTGTTTGTGC CACCGCTCTG GTTGTTGGTA ATTCAAATTT CCAGACAGTA ATTAATGACA GTTACAATTT CAATTAAGCC CACGCGCAGT TCTGAATTGT TTTCTATAAC ATTCACTTTT ATTTTATTTT ATTCTATTTT ATTTTACCCA CTCATATATA CAATTTTTTT CAGCCTTTTG TGGGCTTTTT TTGTTTTTTG TTTGGCGTAT AAAATAAATG GCAACGCCAG CGGCAACGGC GTCTGAAGCT GAAGAGCCAC TCCACTGTAG CCGGTGTATG GGGCCCTCTC GCTCGCACAC GCACGCACCG TCTCTTTCTG TCGCACTCGG ACCA