Vienna Tile Information
VT ID VT008749
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205411
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 208749
Nearest Genes
Gene Nr FlyBase ID Distance
CG31784 FBgn0051784 12744 bp
Sequence Length 2061
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCAAATGCAAACCTCATGCATACAAA
Right Primer CAGGTCGTCTCATCCCGCACAG
Template genomic
Sequence CCAAATGCAA ACCTCATGCA TACAAACTTG CATATTTAGC TCATTATTAT TGTCGGGTTT GCATAATTAT ACGCATTCGA GATCACAGAC GTCATAAAAT TATTAGCACT TTCAACGGGT GCAGTCTGTA ATTGGAAACT CATGTTAATG ACTTTCACTC TTTCGCCAAA GCCAAATGAA GGTTATGCTT TGGCCTTCCG CCCATTACTT CCATTTACCC CCTTTCCATA GCCTTACCAC TTACATATAT CCATGCATAT TCATGGGGCC GACTCACATA CGGCCCAAAC GAAGTTGGCC CAATCATCAT CCAATTAGAA CTGTAAAATT ATACTAATTA CAACTTTGAA ATTAGAAATA TGCAAATCAC AGGGGCGCTC CCTTCGTCTC TGTTATGTCT AGAGCAGAGC TTGGCATGAT TAAAAATTTC ATCAAAAGCG TATAATTCTT GGTGTATGAC CGAGCGAATG TCCGTGAGAG CTGCATATAT TTGCTTAAAT TATATTGACA TCCGACGGTC GTCGTGCAAG GATACGGATA CGTCTGCAAG ACTCCTGATA AGTGAGCAAA CCCAAAGCGA AGGCCATCAA AAAGTATGCG CTTGGAGAAT CAGCCAAGCG GACTCACATA CGGCCACTGA GGGAGGGCCA TACTCGTGAA AGCCAAGCCA AGACCGTAAT GCATAAATTA TGACTGAGAG ATGGCGCACA AGTTGCAAAC TATAGTATAT CATTATAAAA GCCAAATGAG ATCCAATTTT TGAAAGCTAC CAACATTTGT TTAAGCAAGA ACTGTCCTCA AATTCGAATA GTCCATATAC TGTACTCTAT ATGCAATACT CCTACTTTCA AAAGCGAAAT TTGAATGAAT TAAAACTAAA TACTGAAACT TGGTGCTCTA TACTAAATGT CGTGCAACTT TTCCTGTTCG AGATATTATC AATAATCAAA GGCAATCACT GAAGATACAT ATGAAAACAA TTAGTTAAAA ACTGTTCACA TAAATTTTTA AACGTTTAGT AGTCAAACTT AAAAATATGT AGTTGACGTA TAATATAAAT TTAAAAGGAT CTGCGTTTGG CAGTTCCAGA AAAAAGAGTT TGAAAAATAT TGAGGAAAAG GTTAAGCTTA ATGATAATTG TTCACTAATT GTAATGCATT TTAGCCAGCT GCACTCCAAG GGTCACCTTT GAATTACTCC TTAGACACTG TATGATGTGA GTAGTTCTGA AGATGTTATC CTCAAAAGGC TTCCATTTTC CTTTTTGGCC TGACAATTTC CATCTAAGCA TTTCTTGATC ATTTTCCAAT TGACAGCCCG CAGCTGTTGC GCCGGCGTTT CCTGGCTGCC TGTTTTCGAA TTGTCGAATT AAAAAGGAAA AATGTTGAAT TTGATTAGCG AAGCGTTAAA GAAAAAGACA CACAGTCCCG AAAGGAAAAA AGGAGGCAGC TAAGAAGGCC AAAGATAATG AGCCAGTGTT GAGGCGTCGT TTAAGCGAAA CTTTTCGCCC TCCGTTTTTC CTCTGTACTC AAGCCGAACT AACGGCAGTT GTCAGGACTC CAGGGATTCG AATTCGCAAA TGGTCAGGGA TTCCGTAAAT GTGTTAAAAA AACACATATA GTCAATAATA TATATTTATG AATTTTATCT TATCTTATCT AATAAACTTT TGGGTACATA GTATATTCTT ATTCATTTTT AGGGATAACA AAACATTTGT TTTAAACGAT GAAAAAAGGT TAATACGTTT TGACCCATCC CTGGTCAAAT AGTTAGTCAG CCGAGCAAGA GGCATCTCCC ATTGGCAGTT ACACACTGAG TACATGAGCA ACTGCAGCTG CTATTCCGGC CACGCCCCAA AGGGCTTCGA AAAAAGAGGG AATATGGAAT GAGTAGTTCG CTTCTTTAGT GGATAATTTT GTAATTATTT AACTTAATGG AAAACAAACT TAATTTTCAG CAGCGGCGAA GAAAGGAGGG CTTATAGAAA AAGTTAGCCA AATATAAAAC ACCAGTTCAA CCCTGCACGT GATACAACCC TGTGCGGGAT GAGACGACCT G