Vienna Tile Information
VT ID VT042697
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205363
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 242697
Nearest Genes
Gene Nr FlyBase ID Distance
CG10342 FBgn0027109 0 bp
CG12783 FBgn0038448 1745 bp
CG10345 FBgn0027562 4949 bp
Sequence Length 1921
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGCGTCCGCTGATTACACAGTCATA
Right Primer ACCCTTGAGTAAGATGCGATGCCAA
Template genomic
Sequence CGCGTCCGCT GATTACACAG TCATACAGTC CGACGAACAA TTGCATTGTG ACACCGTTGC GCTTTCCAAT ACTCAAACTC CCAGTTGAAC CAGGTAAGGG TTTTCTAACG GAACAACACC CAGGCCCGCT GCCCCGTAAA TCACTTAGAC ACTTATGGTA GATAGATATA TCAAATAATA TAGTCAAACA ATGAGCTGTC ATTTAGAGCA GGTATGGCAA ATAAAAGCGC TTTCTTAGAA CTATTTTATG AGCTCTTTAG TACGAATAGG CCCTAAAACT GTGATTCATA GCCACATCCT TTCGGTGGGC GCAAGTCGGG TTTAACTAGA GGCTAAGTGC CTTATAATTC GCGTAATTCT CGTAATTATC GGCTTTATTT GCTTATTTTC CGGGCCGAAG TATGAGCAGC TTGCGTCAGT CCCGCCCAAA AATCATTGAG GGACCATAAG TGACGGCAGT AAGCTTGTAC GATCACTTAA CCGAGTTATA GCCTAGTTTT AGTCAATTAG CATACTAGAT TGCCCGCTAT TAAGTGAGGC CCTCCAAAGA TCCAGACCCC TAAATAGGTC CCCGAGCGAT ACGAGATCTA AATTACTTAA TATTGGTAGT TAATTCTAAG GTTTTTTTTT ACCCTGTCAT CGATTATTGT AAATGGAAAA ACACCATCTA ATTATAAACA AACATTGTTA CGCTCACGTG TTTTACTTAA CTATTCATTT TTATCGATTC TGTAAACAAA AAACTATTAT AAATTACCAT CGGTAATATG TGTGTACGTA TTTGGTAAAA TTATAAATCA AAAAGACTCA CAGAAAATAA CCGAAGTTTA TTGTGTTCGC TTTTATTAGC TATTGCTAAT TTTTTGCGAC CTTCCCTAAC TTTGCGAAGT ATCGAAATGT TAGCATGCCT TTCGGATTCT CATGACAAAT TACTAAAAGA ACAGTGATAA TTAAATTAAG CTTAACTGAG TTAAGATATT ATATAGCTCT ATAATGATAC ACAAAACATC CTACATAAAC ATACATTAGC CATTTATAGA ACTATGTGCC AAACAATGCG TTGCATCCTG GTTGCCTGTG TGGCCCTTGC CCTCCTAGCC GCCGGCTGCC GAGTGGAGGC GTCCAACTCC AGACCTCCGC GAAAGAACGA TGTCAACACT ATGGCTGATG CCTACAAGTT CCTGCAGGAT CTGGACACCT ACTACGGCGA CAGAGCCCGC GTTCGGTTCG GAAAGCGCGG ATCGCTGATG GATATCCTGA GGAATCACGA GATGGACAAC ATAAATCTAG GAAAAAATGC CAACAATGGA GGAGAATTTG TAAGCATAGA ATAACTGACT TTTGGGCGGA AAATTATAGA TTTATGTTAC AGGCTCGCGG TTTTAATGAG GAGGAGATAT TCTAAATCCA TTTTAGACGA CCATGGCAAC GTCACTAACT CATGATGATA GTTATTAGCA TACGCATTTT TATTTAAATT GTTTTTCGGG GCAATAGTTT AACGTGCTGG GAAAGAACAA GTAGTTGCAG CTACAGAAAT AAGTATTTAC TCTAGTCTTG ATGTCGGTTG AATAAATGAA TTACCCCAAT AATCGATGTT AATACTTAAA TAAATGGTGC AAAGATCAAA TTATGGTTTT CACTTCAGCA ATATAAAAAA TGAAATATAC AGCTTGCTAC CTTGAGTATA CTACAAGTCG CTTTAATGAA AACCCAAAGA CATGACATAC TTGCCTACTT TTGGGCCGCG CTTTAATTTG GATAACATGG CTAAAGAGAG CAATTACTTA TTACTTATTA CATATTCCCT GAAGTCACAA TGGCAAGTAC CCCTCCATAC AAGCGGCAAC TGTAGGTAAA GCAATTAGAA ATGGCATAAC TTATATTCAA GGATCATTGG CATCGCATCT TACTCAAGGG T