Vienna Tile Information
VT ID VT029818
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205271
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 229818
Nearest Genes
Gene Nr FlyBase ID Distance
CG10601 FBgn0014343 28719 bp
Sequence Length 2180
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CTGAAGGCTCATTAAGGCGCTCGAC
Right Primer CCGAAGGATTAGACCAGGCGAAAGA
Template genomic
Sequence CTGAAGGCTC ATTAAGGCGC TCGACGGTGG CGTGGGCGCG GGGCGTTTAC CGCGATTCGG TTGCAATTTC CATATGGAAA TTGAATTTCC ACCGGCCTTG ATGTGGTTTT CCCAATTGAT GCGGGGGGGG GGGGGCGTGG CCGCTCTGGC CCAGAGGTGC GCACTTTTAC GTGGACAAAC AGCGGATGAA ACGATGTTTT AATGCCCTGC TAGGCACTGT TGACACTTTG CAGACTCACT GTCCGCTGGA TTAAATGATG GCAACGGGAA GCAAGACGAC GGCATAATTT AATTAAAATT GTAAAATATT TGTCGGATTT TGCATAAGCT TGTAAAATCC CATTAATTCA CAGAGCAACC CATTGTTGAC CGCAACACAA TCAAAATATG CAAATTTATC GCATTAACTC GAGAAACTCC AAATGGCCGA CGACGACACC AAATGGGATA GACAGTCGAC AGTCGGCGAA GAAATCGCGA AAACCCGGGA CCATTTAATT GGGAAATGAG CATCCGCCTA TATATTTACA TACCTTCCCC CTTTTCGAAG GATCTGGACT GGATGGTGGA TAAAGGATAA TGGAGATGGG CTCAGTTGGC GGTTCTAAGG TCGCTTGTTT CATTCGCCAT GATTTGCATT TTTAATACCT CCAAGCGACG ATGGGAATCC ATTGGTCTCA CCAAGATAAA TCCGGGAGTG GCGATTCACT TTATTTATAT TATGTAGTAC ATATTTAGGC GTATCAAATG CCCGACTTAA GCTGTCGCTG GACTCTCCTT TGATTGCCAC ATTGAAAGCA ATGCCGAATT TCATAAATTA TCAAACGTTT TCTTGTGGTT GCCATAAAGG CCATAAAGCC AATGGCTCAA GTTCCGGTTA TTTATGCTGG CCAATATGTC ACTCCAAATC CTCTTTGACC GTCTACATGA CGCCTGGAAA AGGTGTGATT GACCTAATCT TCAGCAATGC GTAAGGATAT AACCACCGCC ACCGCCGTGC ACTAATAAGC ACATCAAAAA TCCGCACACA CACGCCCCGA ATAAAAAGTC AATCCTGTTT AAAATTTTCC ATGCTTCACG GAATTCAATG AGAAGTAAAA AAGGAGCATT GTCGTGTAAA ATCCCAACAA CCACTCTGTA TATATATATA CATATATGAG TTTCTATATA TCCTTTTTCG CAAGGACGTG TGTGTGTGTG TGTGTGTAAC GCCTCATGTG TAAATCCTGA GCTCTTAAGG AAAACCTATG GCCACAATAA GTGAATGTTC CCTTTCTTCG CCGAAGTGTT TTCCTTATTG TTACTTATAC TTCGCCATAA AATGGACAAT GGTTTTGTAA AGGTTCGCAT TTCATCGATT TATTTAGAGC TCCGAAAACA TATTTTTGCA ACTTTATGAC ATATCCATTT GAAAAACACA TTTGTGTACG CAATACGCAA AGGTTTGTAA TACCTTAAAT AAATTTGGCT CTTACTTTAG CTATCTTTGG AATTTTAAGT TGCGTATTAT AATATATCAA ATAAATATTT ATGGAATAAT CAAAACTTTA CCTTATAAGT ATAATAGTAT TATATTGTCC TAAACACTTT ATATAGATCG ATTCTTCAGC GCAAGTTACT AGTTAAGAAA AGTTTAATTT TTATGTTAAG GATCGCATTG CAAAACCAAA ATTTGTGGCA GCTGTATAAG TTGTACTACA CCAGATTTTT GTATAGCCCA ATTATGAGTG ACAAGCCTTT GTTAGCAATT AACATTTGAC GGGCTTGTTA GCACAAGGAT AGTGATTCCA GATTCCGCAG GTGACACGCG TCACTCCCCA CGTCCCCAAG GTCTGACCAA ACTTCTCGAC TATATGCCTT GGAATCGGCA TAGTTAGGGA GAGTGTATGC CAAGTATGGC ATAAAGTAGA AACACTTGTA AAACTAAGCC CTATCCGAGT GAGTGAGAGA CGTGTTTTTG TCAGAACCAC ATGTTCGCAT TTTCAATGGA ACATTTGTCT GTATATATTC GGAGTGCTCG AGGTATGGGG CTTACGAAAT GCGTGATATA ATGTAAATGT AATGAGAAAG CATCATCAAT TTCGAGCGAA AAGAAAATCC CCTTTAAAGC ACACGACGAC AAATGAAATT GTCTAGTTTG GCCGCTGCGA AGTCCTCTTT CGCCTGGTCT AATCCTTCGG