Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT016530
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205174
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 216530
Nearest Genes
Gene Nr FlyBase ID Distance
CG8367 FBgn0000289 0 bp
CG8338 FBgn0033907 0 bp
Sequence Length 2131
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGGCCACCAGTCGTTCGTTGTAATC
Right Primer GGTTAGCGATATATGCATGAATAGCCTAGAAAA
Template genomic
Sequence GGGCCACCAG TCGTTCGTTG TAATCGTTGG GCAGGGGATC AAAGGAGCCC ACCTGCTCGA TGACAGGCTG GTGCTGGTTC TTGCGCCTCT AAACCGGAAA ATACAATTAC CAATTAAAAG TTTTAACCAT TTTAATGGCC TAAAAGTACG CACCTCCATG ACGACAATGT GATAAAAAGG CCGATTGGTG CATCCCAGGC GTACGAAACG TATGATTTTT GCCGACTTGG CGTAGAAACG ACCAATGCCA CTGGCTGGCG ATAGAGACAT CCCGATATTT TATATATCTA ATACAAGTTT TGGCATAAAA TAAGGATTCT TCAATCAGAA AATGTGAATT GTTATGCAAA GCATGACCGT TGAGGGAAAA TTTAACAATA CCAAGCGATT GGGTCACACT ATTAGTTAGC CCTAACAGCG TTGCCACCTC CGACCGCCCA TGTTAGACAG TTGCGGCACC TCGACAACCC TGGCCTGCGC ACACACAAGA TGGCGTCAGA GAACGAGAAG CACGAACACT AAGGAATTTG TTCAGTGGTG TCTGTGTCTG TGAATTATAT TGAAGGAAAA AGAGTGTTTT GTTTATAAAT TTAATTGCAA AAACTGCACA TCGTCACACG GGGCGCGTGC ACACACATCG GCGCACACGC ACACCCACGC CAAGGCGACA CCTAAACGCA AAACGGAGAG TGTGTGTTAT CAATGGAGTG TGTGTTCCCC AACGCCAAGT GAATTTTTTT CGTTGAGACC GAGGGACGGA AAAAAATGGC GCCCGCAGCC AGAGCAACTT GACTTTCTTT TCGGTCCTAT ATAGTTAGTA GTTGCTTGCC CCCGTCTCGT CGTCGGCGAG CGAATTCGGT GATTTTATTT CGATTTCGTC GCAGTGCGAT ATCCCCAACG AAGAAAACAT AACGAATAAT TGATGAAAAA GTGCTTGAGA GAGACCCCCC CAAACGTATT CGAATTTGTT GTGTACATTT TGGCTTCGAA CACAGCCGCA AAAATACCAT TACCAATTTC CACTTACTAC TACTAGAGAG GAGGATAGTA TTTTGTACGT GCTTTAGAAT ACATACATAC ATACCTACAT ATACCACAAG CAAGCGAGAA GTGCAATTAC ATTTGCGTTT GGAAATTTTG CGCTTTTTTC TCTTCCGTCC TCCCATCCAA AAAAAAAAAC CCCCCGCTCC CCCTCTCTCT CTATCTTTCT CAACCCGCAT TGTGCTAAAT AATGTGTGCC GCCCAGAATC CGCCGCCCTT CGGCTATACC TGGGGTTTTG CGGACAACGG CAACCGCGCC GCCGAATCGG TACTGGAGAT ATCGCCCAAC ATCAACTATA CAGTCAGCGG GGAGTCGGTG AGTCCAAAGT TATAGCTCTA TTAAACTGAT AAACCCGTTG AAAGCTGCCA GTCTGAGGAT ATTTCCCCCC TGTTGCCGAC ATTGCTCCAG GTGCGTGCGT GTGTGGGTGT TGGTGCTGCT GTTGCTGTTG CTTTCCCACA CCGAATTGTG TTGTGGCCCA CCAATGCATA CACACAAACG CACACACGCA CTGCGTTACA CTCGCTCACG GACTCGCTCG TCTCACCAAC ACTCGCTGCT TTCGGCAACG AACTGTGTAT GTATACGGCC CGAATGGCAT TCACGTATAC GGTATACGTG GAAAACGAGC GACAGCAACT GCGATATACA TACTTACGTA CATGTACAAC GTATATATGC ATACGCCACA CGCTTTATGT AACTGCGTTG TCATGCGAAT ATACGAATAT GTACGAATGA ACGTACGTAT GTATGTTTTT ATGGGGGGGA TGGAGCGAGT GTATTAGAAT TCTTTTAGCA TACATCCATA CGGATTTTTT TCGTTTCCAT TTCATTCGTA AACATTCATA ATTTGGTATT TGTAAAACGA ATGCGTACAC AATTGGCTCT GTGTGCGGAG AAATTCCCAA AATACAACAC GCGCACCTGG CGAGCAAGTA AATAAATAAA TAGCAATAAA TTCCCCCCAC AGGCAAATCG GAGCAGTTAA TTAGCGGGAA GGTCGTGAAA TTTTCAAAAG TCTGGCAGCT GGTACAGGCA ATCGATGCTA ATCGATATTT TTCTAGGCTA TTCATGCATA TATCGCTAAC C