Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT063185
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205121
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 263185
Nearest Genes
Gene Nr FlyBase ID Distance
CG5488 FBgn0004854 11141 bp
CG5529 FBgn0011758 69610 bp
Sequence Length 2172
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGGGTTTATTTGGGTTAAGTTATGGCATTTT
Right Primer ACACACAAGCTCGGCTAACGGCAC
Template genomic
Sequence TGGGTTTATT TGGGTTAAGT TATGGCATTT TAAAAGATTA AAAATGAGGC CTTATGTGCT AATAATATAA CTAATATTAT ATTCGGTGGT GAATTATTAG ATTAGAATAC ACTAGAAGAT TGTAAATGTA CCATATTAAG TTCCGCTCAA AATGAATGTT TATGTGCATC TTGGGTATGC AAAAATGACG TTTTTATGGT TCTCAGATTT TCGCCCCATT TCCTCACAAC AATGTAGTTG TGGAAATCAG AATAACATCA ATTTAAATGG TTATCCAATT CGTTGGATAT TTATTTATAT TTAGGGTTAA TGTAGTCTAT ACAATATTAG GAAGATATCG GAATATCATG AATTTAAATG GGCCTGTTTG ATTTTATCAC TCGTTTCCAC GATTGCCTCC ATTGTGCAAT GCCATTTGTC GCATTCAGGC GAGTTTGGCA AATTTGTGTC TTTTGTGCAT TCGAGCTAAC AAAGTGCTTT CACACCGGAA GCAATTGCAA TGCGTTTGCC GTCGTCCTTG CCACCGCACC ACCGCACCAC TGATCCACCC AGCCACCCCA TTCTTCTCCA GTTAATTGAC AACTTTCTGG CCAGGGTGCG CCTTAAGTTC GCCCGCTTTT TATCCCATGC CATCCTCCAA CGACTTCTTT GTGAGGCTAA TTTGTCACAG GATGCCAGGA TGATGTCAGG ATGTGAGGAT GCCAGGATGT TGGCATTCAG GATGGAGCAG GCGATGCTGC TTCATTACAC AGGCGATTTG TCGTGCACAA AGCGAACACC AAATCGATGA GAAAATGGTA CGTAATGCCC ACAGTCAGCT AAACCATATA CTATTATAAT TAAATCAATT AAATTAATAA ATAAATCAAA TATTTTATTC CTTATTATCA TTATTGTGAT AAAATATTAT TTCAATATTT TTAATCTTGT AATATAATAG AAAAGTAAAT GAAAAGAGTT TATTTGTTCC TTTAAGCACA CGCTGTCTTT GAATATCATT AACATAATTT AAAACGTATA ATATTATTTG TGTACCATCT TATTTTACAT TTTATATAGT TTTAGGCTCT GTATTCCTGT TAAGATATAA GTATACCAAA TATTTCTCTG CATGTACCCA CATGGAGTCA CCCGGGGGGT TGAAGGGAAT GAGATTTTGG GAGCTTCCGT TATCAATAAA TTTGTGCGCT TAAATGCGTG TGTTTATCGA ATTAGATGGC GGAGGTCAGG AAGTCAACGG AGATTTATGT TCGGTCAAAG GGGCAAGTCA GGCGATGCAA GGTTATGTCA ATGCCGAGAT ACGAGAGTAT ATATTCCTCC AGCGGATCCC GATGCCTTTA AATTACTGTG AATGGGCTAT GTGGCGCCAG GGATCAGAAA AATCGATTTG TCGGTCGTCG CCGCCAGTTA AACGCTGCCA ATTTGCCGCA CTGCCCTCTG GAGCTGCTCT AAAGTTCCTT TGGATGGATG GGGCATCTGG AATCTGGACC TCAAATACGA ACATGGACCC ACTGGCGGCT ACTGGTTTTG AACCTGCCAC TGAAAAACCG ATGCCAACTG AAGCCGCCGG CCCAATTTGC ATGCGTTCGA TTTGCAATTC GCTCTGCAAT TGCATTTGCG GTTTTCGGTT TTCGGTTTTT CAATCAATTC TAACTGTGCA AACTGCAAAA GGCAATCATC AGTCTGTGCA TGAAATTTAC GAAGCCTAGA TCCAGGATCA TCCGAACCAG GCGGGTATCC TGGAAAATCA TTTGCCTAAA GATAATATAG AGTATGCATT TATAACACGG TTTACCTACC CACTAAATGA ACAACTTCCA TGTTCGAGCT CAAGGCGAGC TTGTATAAGT CATGAACTTC CTAGTTTATC CATTTAAATC AGGTCTCTTG CGTTTGGATT AACATCTCTG CAATCCCCAG CTTAACATAC CCCTCCGTAG GGTATCCAAA ATCAAAACTT GATTCCCTCG CCTTCGTGGG GCACACGCCA ATGTCAAAAG GTTCTCACAG CCGAGCGGCG GCGACGATGA TGATGATGCG ATGATGATGG CTGAAAAGGC GATCCCATAC GTGGCGATGT GATATGGCAG TAAGCCGATA CTTTCCCGGA GCTTTGATAT TATGTACTGT GCACTTTTTT GTGGCCAAGT GCCGTTAGCC GAGCTTGTGT GT