Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT027263
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205106
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 227263
Nearest Genes
Gene Nr FlyBase ID Distance
CG17888 FBgn0016694 23079 bp
Sequence Length 2162
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TCGCACAACAATTTTCTTTCACTGCTT
Right Primer ATAGACGTGTGTTGCCAGGGGGATT
Template genomic
Sequence TCGCACAACA ATTTTCTTTC ACTGCTTAAT CCAAGCGCAC CATAAATTAA TCTTCTGATT ATGTCAAAAT CCCTATCCAT CACTTTAATT ATATATGACC CACATAAAAA TATGCTTTAT ACGCCCGATC ATAAAGTACC CATTTAATAG AACGACTAAA TTTAAAAATT GAAAAACTGA TAGCTGATAA GCTGAAGCCA GTAGTCGAGA CGCCACAAGT ATCGATGGGC ACTCGAATTG GGTTTTATTT ACGATCCCTA CCAACGCAGC CATATCCCAT GGATAAGGTA CGTAGCTGTG ATGGTAGTAA TCCAATAAAT TACCAAGAAA CTTGGTTGTG CAAAGTGATT ATCGTCTCCA AATTGATTGG CCATAAATGT GTCGAGGTAC GTATCTGTGG CCAGGGAAAA TGTTGGATTA AAATCGTTCT AATAATTTTC TTTGTCATTT CTGGCAGTTT CTGTATAGTG CAACACCTCG TTCGCAGATC AACCTTTATT GTTCATCTCA TCTCCGGTCG TTTATTGTTC ATTTTCATTT TGCCGGCCCA ATTTATTGGC CCCATGCCAG GAGGCGGCAT TCTCCTGGTA TTGTATAATG TCCATATCTC TATATCTATA TCCATAACCA TAGTCACATG CGCACATATA TACATTCTGT GTAAATATGT GGTGTAATCA GCTTGTGCCT GAATTTTGCT GTTGAGTGTA ATCAAGGCAA TCAAACAACA AATTTTCACA CTTTATTGCA GTTGGGAGAA ATTTTCTAAA ATTTATCTGC CTTTATCTAC CCAATAGTTG TTAGGGAATT TTTATTATTT TTTATTTTAA GTAATATATT TGTGGCTTTT TTCTTGTATC ACTTTTATGT ATCTTGTGGA ATTTATTTGG GCTTTGGTTG ACATATATTT TTGATGGCGG ATTAAGTTGG TATATACAAA TTAGTCAGGG ACATTTTTCT CACCGAACTG CGTCACTCAG TGATTTATGA AACGAGCTAG CAAAGTTCTA GTTCAATGAT TTTTATAACT TTAGAGAAGG TAAGTAAAAC ACTTAACATT TAATGGGCAT ACATTTTTAA AACCAATATT TTACAGAATT TTTTCTACTT ACTCTGAAGC TCCCAAAAAA GAAATTATAT TTTTTGAATA AAAACTGATT TATGCGAATC TTAAATTTAC CAAGAAATAT TACATTGCAC CAGCTACCGC AAGCATTTAT AATTTCCTTC CATAAACTTC TGTTTCTTTT TGGGCAAAAA CACGATACAA ATTGGGTTCA TTTCTGGTAG CCTGCAAAAT GTTTCAACTT CCGCAGCTCA TTCAATCTTA TCAAACGTCC TTGGCTGGCG CAGTCAAAAA AGTTTTATGA CCAGCTACCC AAAAAACTTT GGGGGTTCGC CAGCAGGGGG AAATACTTAA ATTACCGCCA ACAAAAATAC AAACAATTCG TATTTAACTC GTTTAAATGA GCAATTCCTA CATCTAACGG TGGAAAAATA CCCATGTTTA TAGAGCAAAA GGAAAATTAG AAAAGTCTAA AGAAAAGCGC ACGAAAAATT ATGAAAAATG AATGACGTCT AAATGTTCGC GAAGGTTAAG ACAAATGGCA CATGTTGTCG CCCATTTTCA GGGGGAATTG ACAAAAAGTC TTAAGAGTCA TTCCCTCAGT CCACTTTTCG TGTCATGAAA AATTGCGCCA AGATAAATAA TTCCAAAAAG GAAAACAAAT TCGTTAACAA AGGCCAAGGA AAAGAAATCA AATAGAAATG GATATCAAAG CGAATGACTC ATCTGCGTTT TGCCTTTTGT GGTTTTTTGG GAGTGTAGCA GATGTTTCGG TTTTCGGAAG AAATTCGTTG AAATTTTGAT GGGCTAAAAT TTCATTCTGA TAATTGCGCT GAGCATTTGA CTCTTTAGGC ATAACAAAAC TTCCTCAAGG TGTTCTCCCC CTTACCCCCG TCGCCATTAT CCCTTGATTT CAGTCTTTTG GTCTAGGTAA AATGTAGCTT CAGTTTTTGT GTGCATTTCT GGCCATGAGC CAAGGCGTCT GCCATCTTGA TAAAGTGTTG GCCAAAAAAC GTACGCCACA TTAGTGGCAG ACTATGTGCG GGATGGGTGG CGCGGGGGTG AAGGGGCAAT CCCCCTGGCA ACACACGTCT AT