Vienna Tile Information
VT ID VT065322
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205043
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 265322
Nearest Genes
Gene Nr FlyBase ID Distance
CG14584 FBgn0031181 18124 bp
CG1644 FBgn0031182 19902 bp
Sequence Length 2201
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer CTTGGGCAGTCGCACACACACATTC
Right Primer CCTCCTCCGCTGTGTCGTTCAGTT
Template genomic
Sequence CTTGGGCAGT CGCACACACA CATTCGCAGG ATGGCATACA GTAACGCACA TGCACTGAAA AAAACCGCAC ACTTTATATT GGATTTCATG TTTTAACCTT AATTATTATA TGATATGAAA AATGTGTTAC CTTCGTTTCA TTATTCAATT AAAAAATAAT AATTAGAAAT ACGTTAATTG GAGAATAAAT CGAATTGCAC CTTCATGAGT GTATCTTTAA GATACCTCTG AGTTCTATGG TAATTTTTCT CTCTGTGAGT TACACACATA CATATGTACG CTTGTGTCTG TATGGTCACA CTCACACAGA GTTAAAGGAA ATGAAAAATT CTTAGTAAAA TTCCCATCAT CCCTTATTGT GCTCTGGGGC ATTTTGCTCC CGATTTTTCC TCAACCCACT AATGCCATTT TCTTGGCCTT CCCCTTTCCC GACACCCACA TTTTCTATAT TTTTTTTTTA ACGAAATTGC AATAGTGTGT GCTTAGTGTG AGTGAGCGTT GACAATAAAC ACACAATATG TAATAAAATC GGACGCGTTA TAGAAAACGC CGCGGGCACC ATCAACGATG ATGATTTCGA GATAGGAACG GGATTAAAAG GGAAAATGGG AAACTGGGAA ACTGGGAAAC TGGCAGGGCG CCAGTCCTGA GCATAAAATA TAAAATTTAG GAGAAATATA TTGAATTTGC CCGGAATGCA ATAAAAAGAA AAGATAGGCA TTTGCCCAGA GTCGAACTTT TAAACATTTC CTACGATGTA CCGTCAGCTA ACAAAGGCTG CAATGAAATC CAAATAGTTG TATTAATGAT AAATCTTATC TATTAATTAT AAATCAAAAC AATTGGATAA AACAATTTAT TGAATTCACA CCAAACAAGT AGCGAAACAT GAAACTGAAA GCTCGGCTGT ATCCTCGAAG TGACGAAGTG GATCGCAAGT GTGGTAATCC GAACAAAATC ATTTGTATCT GGATGTTAAG CTATTTTGAA ACTGTATCTC ATTTTTTGAA TAAACAAAAG AGGATTAGTT TACGTTACTT TTTGGACCTG TTAGAGCCGT CGGATCAAAA TGCCCAGACT GCTTACTTTA GCTCAAAATA CGTGTCGACA CCTTTATCAG CATAATGCAC GTATGCATTT GCACGCATAT TATAAAAAAA AAAAAAAACA AAACTCGAAC AGCTTTTATG AATATCTCTT GATATATTTC TGGTCTTGGA ACATTTTCCG AAATTTCATT ATTATCAATA TTAATAATTA CTGGTATTTG CGCAAAAATA AGTTAATTGA TGCCTAATTA TATTTCCCAT GTTGAATGAA TCGATAATTT GCTAACAATG ACTGTATGCC AAGTATGTTA TCCGGTTATA GATTTAATTC CCTCCACTCA TGCCTGATTC ACTAGATCTA AGCCTCCAGT CTCCCCGCCT TTCCAGACCC CTCCTCGAGC TTTGGAGCCA TTAAGCCAGC ATAATTGAAT TCCGCCTGCC CTGCAGGTCC AAGTATTTGT TTGTTTGCCC AAGTTGTTAG CCTTTTGGAC AAACTAATTA AAATAGCAAG CGATTTGCGA GCAGCCTTCT CCCTCACTTG ATGGTCTGCA TGAAACTTTT GGTCAAACGC AAAAAGCCAA AAGCCTTGAG TTCTTGGTTT TCCTTGGGCC AGAGTGGGGA AATCTGGGAA AACTGCAACA CATGACGACC AAAGTCAAAT ATACCCAAGC ACAAGGATGC GAGCATTCAA GGAGCAGCAA CAGGATGCAG CACCTAGGAC AATGCAAGCA GGCAAACACA ACAAAATGCC AAATAAATAA ATATTAAGTA TTTGCAATTG TTGTTGAATT GGCCAAAGGG CGAGCGGAAT AGTTCGAGTA TAACGAAGGA CTGGCCAGGA CTCTCCGGTT CGAGCCATCT GCTGATTGAT ATATTGTCAA CAGAGTGGAG GTCCGGAAAT TTACTCGAGG TGAAACCGGA CTACATCGCA TTAATCCCGA ACCCGTTCTG ACCTTTGATG GGCACCCAAA TTGATTCTGT CTGCCGGCTA TTTATTTGCG AAAGCGACTA CAATGCATAA TTTAAAGGAA ATTGTTCTAC AAATAATGCC AATAGAAAAT CAAAAAATAT CTTGTAGCTA TAGGTAATTG CCTTCTTGCT CTTCTGAATT TGCATACTTA AAATCTTAAC TGAACGACAC AGCGGAGGAG G