Vienna Tile Information
VT ID VT049118
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205015
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 249118
Nearest Genes
Gene Nr FlyBase ID Distance
CG14521 FBgn0039617 17816 bp
Sequence Length 2076
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CTGGTGCCGTATGACCTTTGACCC
Right Primer CTACGCACCTCCTCCGCCTTCTGT
Template genomic
Sequence CTGGTGCCGT ATGACCTTTG ACCCAGCTGC TACCGCGTTG AGCAGAAACA GCGACAGTAG CCAAATCGGC AGCTGCTGCT TGGCGGTCAA AGTTGCGGAT GAGGGCTGGA CATTTGTGCT CTGCATATAA ATCGATGCTG ATGTTGATGC TGTGAAAATT TGCTAAAATA ACTGCAGACA CAAACACGCA CGCGAATCGA CACATACTTG GGCAAAAGCA ATTAAACTGC TAAAACCACA TTTTGTGCGA GAAATAATTG CGAAAATGCC AAAACATAAA GCCGAACAAC AAACATAACC GAGTGCCACC AAAATCGAAA AACAGAGAAA AACGCACCAA ATTTGTTCAG CCTAAAGCAG CCGCCCCAAT ATGTAGCAAC AACAGAGCAT CAATTACAAT CGCAGGGGGG ACGGAGTGAA ATGGGGATTT TTTTTGTTGG TGCCAAATCA GGGGGCCAAG CAGGCCCAAG GGGGATGAAA AGGACGCAGG ATACCGGTCA TCGAAGCCCA ACTGGCAAAA AGTCAAACCC AAAACGGCAA GGACCGAAAA AAAGTGGCCA AATGGCAACA ACAAATCAAA TATATTATAA CGCACAAAAA CAAACCAAAC TCAAATGCCA GCTTCAATAA CAATAACACA GTTGGGCGGA GACGGGGGCG GGCACGGCGG CTGGTGGGTG GCGAGTGGCG GGCCGGGGGT TGGGGCTTGA ATGCTGGAGC AGGGGTCGAA GGTTACTGAG GTGGCGCTAA GGGGGGTGGA ACAGTAACGA GCACTGACAG AATTCGGTTG CGGCGGTTTT GTGTTTACAC TTTACAATAG GATTGCCGAG GCTTTGGCGG AATTTCACAT TTTTGCCAGG GGCTTTCTAA TGAAATCTCC AAAGGCAACA AATTAGTTTT CGCTGTCCCC AAAATGTGTC CTCTGTAACG GAGCTGGGTG GTTTATCTGG AAGTCTAATG GTGATATTGA ATAAATATTG GCACAAGCCG AAGGGCTTTT GGGTTGCAGA ACTTTTGCTC AGCTGTGATG TTTTAATTTA TAATTACGCT AAGGGTAATA ATAGAAAAGG ATTAGTTGAC TTCATCTATC TGTGAGCATA TATATATATA TGCAAATCAG TAAGTAAATT CCCATAGACT GGTATCATCT GTTTTAAAAT ATCTGCACAA TATATTCACA TCCTTAACCA AGTAACCTCA GCTTTCAATT ATCAAAACTT GGACCGCCTC AAAGACGATC GGTTTCAAAA CAAATCACGG GCCCAACGCC AAAGTTTCGC CCAAAATTGA TGCCTTATGA ATCGAGAGCG CCTATATCCG CGAAGGACCA ACTTTGCGCC AGCTTTGGGC CGTTGCAAAC TTTGTTCATA CAGTCCGATC ATAAACACAT CCAGCCACGA GCCCTCGAAA GTAGGCAACA GATGCGAATG CCGCGGGGTT AGCGCAGAAA TGCAAAAAGC GAAGTGCGTA AACAGCCAGG ATAACGAAAA CAAACAGGCG GCCAGGACAA ACAAAATGAA TGGCGTTCGC GGTTGAGCGA AAAGACAAAT TAAGATTATA AAAAAAAAGA AAATAAATAT AATAATAAAA ATAACACATA GCCCAGCGCA GGGCAAAAAG AGCGAAAGCA GGGAAACAAA AAAAAAAAAA CAACGCGAAT TGATTGATTG ATTTATCAAA TGTCTGCCAT GGCAATGCCA AGGTGTGCAT GGGCGGGGGC GTGGATTTCT CCAAAGCGAA AAGGGGGTGT GGCTGGCTGG TGGCAGCTGC GGCATGGCCC TGTCCATATC TTTGTCTGCG ACTGTGGCGC GTTTGTGATT TGACAGACAA ACTGACAGCA AGACGTGCGC AGCGACAGTC GGTCCAAAAG GCAGGGGGCC TTCGAGAGGG TTTTTTGGCC GGGTGGGGGG GGACTAAGGG GTCAGGCGCT CCTGGCAGCG TCGACTGCCT GTCGGCGTTT ATGTATGCGC GTAATTCCGG AGGCCAGTTC GCCGGAACGG GAAAGATGGA GTGAACTGAA CTGAATTGGA GCGAAGTGAA GTGGAGCACG AGACAGAAGG CGGAGGAGGT GCGTAG