Vienna Tile Information
VT ID VT010055
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204990
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 210055
Nearest Genes
Gene Nr FlyBase ID Distance
CG10443 FBgn0000464 1593 bp
Sequence Length 2343
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AATGGTTTTTCAGGCCGTATCTCCG
Right Primer TGGGACACTTGAAAGCGAAGAGCAA
Template genomic
Sequence AATGGTTTTT CAGGCCGTAT CTCCGGCCTT CCCTTCCGGC CTTTTTTTTT TTGCTGTCAC CAAACCCTTG CAATCCGGCT CGAAGGACCA CCCACTTTTG GCCAGCTAAT TTGTCGTTTG TTGCAAAAAT ATGACACAAA AGCACCGCTC AACAATTGCC GACTTAACTC AACTGTGTCC AGCTCCCAAA TATATTTCAC GCAAAGGGAA CTAACTCATT TCGCTTTGGT TTTTTGCAAC AAGTTTTAAT TAATTTGCCG CAACTCCGGG CGCCAATGCT CCAATCTCTT GCTTTCCTTT CCATTCCCAG CCTTTGCTTT CATTCCACCC ATCAGTGGCA AAAAAAAAAA AAAAAAAAAA AGAAGAAAGA TGGAGGAGCA AAAAGTTGAT GCTACGATAA TTTGAAAAGT TTTCGTTTAG ACAGCGAGAG CGGGCAAAAA AAAAAAGAGA AAAAAAAAAC GAATACACGG GAATGTGGAA CAGCAAATGT CAGAGAAGGC CTGGGAAAAT CGCTTCCTAA ACTAAAGCCG CTCGGCACTA AACTATATGT GCGTATACCA CCCATATACG AGTATAGCCC ATATTAAGCC GCAAATAAAT GCCGGAACCA TAATTAACAT ATAGCCAAAG TTTTGCCTCA TCCTTCGCCG AAAAGCCGCA AGTTGAACTA CGCGAGGGCG GAAAAGTGTC TGGATGAAAT ATGGTTAAAG TCGATTTTCG CCCGTGTTTG CTTTTTGTGG GGCAAAAGTA ATCCGAAATT GATAACTTTC GGCTTGATGG AGTTCGCCAA GCGAAAGGTA ATTAAACGGC AGACGCAGAG TAATCGGCTG GGTGGGAAAA TTCCAGTTCA GGCGATCACA AATCAATTCC GAAAACTTTT CCCATGAATA TATGTTTCCA CGCTTTTGAA AGTCGTCTGT GGGCTCATCA CTTTAGTGCT TGATACTAAA GTATTTAAAA TAAAATTGCA CTTATATATT TTCTTTTTAG TTACAAATCC TAAGACATTT GGAGTTTCAT TTCAATCATC ATTTGTTTAC GTCTGACACT TGGACAAATG GGCAACACAA ATGCGTGTGT AACTTGCAAC GCCGCATATC ATTATATTAG CAAACATTTC AGGATTCGCA TATATCTAAG TTGTTCCTGG GTAATAATGT CCTGGCATTT ATCACACTTT TTCGCGTTGC TAGTCGACGG ACAAGTGACC AGCTAAAGTG GCTCTAAAAT TTCAGTGCCC AAATGAGTGG AGGACCCACC TCCCACTTAG TGTGCTACAA AAAACCAAAA AAAAAAAAAA AAACAAAACA CCGAGAACGT CGGAATGAAA GAAAGATAAA TAAATGTTGG CAACAACAAA GAGCAAAGCG CCATAAATCT AAATAACAAA TTTTTACGAG AAACGAGGCC ATAAATAAGA TGTTTCTTGC GGCCTAGCGA AAAATAGTGT GGACCTTCGA AGGGGGATTC CCCAAAATGT TTTTTGGCTC GGACCATTCA GCATTCAACA TTCAGCGTTC TCCATTCACG GTTCCACATT TCCCATTTCC CAAAGGTTGT CTCCGGCCAA GCGGCAACAA TTCACCAGAG TTCTGTTAAT TTAATATTAT TACTTTTCAT TACAACGAGG CCTCCTGCTT CATTCCCCAT TTGCCGCAAA ACGCTGTTAG TTTTTTTTTT ATTTATATGT TTTTGTGGCA AGCGCGTTGG CAATGCCACC CCAAAATGTC AACACATTAA TGCGAGTGGA GACGGACGGC TTGAGATAAA TCAACATTTA TCTGCGGCCA TTGCTGACAA TTGAAAATGA CCGTTTATAT CTTATGGCTA ATTACGACCT ATTAAAGGCC CTAAATGTAT TTTTTGGCAA ACGGCAAACA TTTATCAATG CTGAAAGGAA AACCGCTGCT GGCATTTAAA TGGCAACTCC TAAGAAAATC GAATATTTGT AAATTTAAAA TTATGCTAAA TGGGAGTCCT GTTGCCAAAT GCAACAAACA AACCAAACAA ACCGTGATCA GTGGCAACAA TAATTCTTAT GAGAAGAAAA ATTCTTGATT TCGAGATGAA AACGATCTCA ATGCTAATAT TTTCCACAAT CTTAACTTGA ATTAAAAATG AGAGAGTGAG AGGCACAAAT GAGAGCAAAA TCCTTTGATA CTAAGAATAG TTCGATCTCG ATATGAGTTT GCTGATCTCG ATTTTATCTT GGCTAGATTT TGAGATCGAA ATTCTCAAAT CGAAATCGTT GAGAACGCGT TTTTTCTCTG AGTGTGGTAT GTTTTTAGGT CCTTCCAGTA ACATTTTATA CAAATACATT GCTCTTCGCT TTCAAGTGTC CCA