Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT033934
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204830
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 233934
Nearest Genes
Gene Nr FlyBase ID Distance
CG4717 FBgn0001320 0 bp
CG34260 FBgn0085289 11531 bp
Sequence Length 2556
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGGTTTGGGAATCCTCGATGTGTGT
Right Primer TGGGCAATTAAGCCAGAGTTGAAAAG
Template genomic
Sequence CGGTTTGGGA ATCCTCGATG TGTGTAACTG ACACTTCGGC TACTAGCTGA CGACTGATTT CTGGCTGAGA GGTTCGACTG GCAAGAAGCG TTTCTGTGTT TCGCCTACTG GCCGAACTCT TTGGCTTATG TACTCGCACT CACACCAAAG CAAACTTACC AGTTTTCAGC CCCAGCTCTC TGATAAATCA CGGCTGAAAC CACCACCTTT AAGACTCGGA TCGAGTGAGA GAGCGATCGA GCACGCACAC ATGCGCATTG AGTTCGAACC CCACTCGAGC GAAATGTTAG CAGAATGTTA ACGCTCTGTT GTTGAATGAA TAGAAAACAC TCACTCACTC ATTCAGATCT CACGCTCAGT CTCTCTCTCT CTCTCGATTT TGAGTTCCCT GTAATCAGGC TATTTGCATG GCCCTGATAT TATTCGTTAT TCGTTTATTT ATTAAAGATA CTCGCGTGCT AAGGGCGGCT GGATTTCTCA CTCACTCGAA CACCACACAC ACACACACAC ACCACATTGA CTAAGCTATT GACTTCATTT TTAACAGCTG CTCATTTTTT TGGCATGGGC GGAGCCGTTT TGGCTGCTCG AAATCGAAAT GGTTGGAGGC CAATTCGCTT GGGGTTTTCT TTTCAAAGTC CGCCGGTTTT TGGGTACATT TAGAGTTGCC TGTATGCCTA ACACCTAGTT TGATTTTCAA AACCTTTTTC CGCGGGAAAT ATTCCCACTT TCTGTGTGAT TCACAAACTG ATTCTCAAGA TTTCATGAAA TGTGTTAAAA TTTGCATAAC CGCGACTTGG CAATAAATTG AAACGCTTTA ATTAGAAGTT AATCAATAAG AGATCTGCAT TGATTCATAG CAAAAAAACG ATAGTTGAGT ATTATTGAGT ATGTAATTGC GTCCGAAAAG TTATAAAAAA TACTATTTAG ACGGGCTATT ACCCGGATTC AGAATGATTC ATATTAAAGT AGTTGATTTG CAAGCTGGTT CTAAAATAGC ATACAAAAAT AGGTTTAAAC CATACAAGTT CAATATGAAT AGAATATAAT TATAATTATT TTAATAATTT TATTAATATT ACACTTTTAG TAGAGTAATA TTTCGCAAAT AAATCATGAA ATTATATTAT TCTTAAATAT TATAAAACTT TCTTATCCTC TCCTTCACCA TCATTATACT CAATAAAATA CAAATATCAA TCGAATTTAA TTGTAACCCT TTTAAAAGTC AACTTCCAAC ATAATTTCTC CTTTGTGTAA ACAAAGAGCC TTATGGCGGC ACTTAACTCT TTTTATGAAT ATTTATTGTT GTTTGCTCAA AGCCAAAAAG AAAGAAGGAG CTACCTGTTT AACCCTTTTA TGCCGCTAAC CGATGTGCTT AACCCTTTTA TGGGCGCGCA TTGTACCAAA AGGGTTGTTC AGACCCAAAG ACAGGAACCT TGACTTTTTC ACTCCGAAGT GTGGCTAGTA TTATAAAATA TAAAACTTCA ACCGATGTAC TAAACCATGT CTAAGGTATA CTCTTAACAA AAACTCGTTA GCTGACTTCC CAGAAGATTT TCCATTTGAC TTTCATTTGT TGCATCAGGC AGAGGAATTC CGCGTAAAAA CGGGAAAAAA CGCACAAAAG GCTTGTAAAA AAGTCAAAAA GCAACAAGAA CCATTCTTCG TTTCAATTCC GGCATCTCGT TTTTCGCTTA GCCACCCACC TTTTTTCTAA TCGATTCATT TTTATTGCCC ACCGTTTTTT TTTTTTTTTT TTCTCACACC ATAAAAAAGA CTCGTTGTCG AAAATTCGTT ACAAAAAACG CAGTTCAGGC GTTTTCGCGA ATTTCCGCGC AAGCCAAATG GGTAATTTTC CCGGGGTAAT TAGTTAGCTC GAAAGGAGAG GAAAAAATGA GAACAATGTG ACTTTAATCC GGTTTAATCC CCGGCTTAAG TTTTTTGCCG CCCAGCAATG CGTTCGCATC TTTCAAAAAT AATAAAAAAA ACCGAGCCGA GTGTCGCGTC CGCCGTCATA ATTATGATCC TAGGATAATC TGCAGCTTAG GTAAGCTGAT CCCGCGATTA GGTAACGAAA TCGCTGGCTT AGGTACCCAC AAGAATTGGC CTAAAAAACT CAGCCTGCGT TCGGGCCACG TTTGCACGTT GTGGGCCGTG CGAGTCATAA AGTCAGGCCG TTCGGTCGTA ACCATAAAAA TTGTCGAGCA GCCGATGGTT ATAACCCGAG CCAAACAAGA GCACCCGAAT TCCACCCATC CATCCACCCA TCCGCAATTT TTTAAGCGGA AAAGGGATAA AACGGCTGCA TCTCGGCATA TGTCTTCACC TTGAAAGACA GCGGGTCTGA ACCAGAACCA GGACCTCATA TAAAAAAGTC AATTGCCGCC GCTAGGTTGC GTAAAAAATG ACAAATTTTC CCGGGAAATA ACCTCAAGGT AAGCTATTGC TAGAAGGCTA AAAAACAGTC GATTGGTAAA AAAAAAAACA CAATAAAAAA GTAACGCACA AATCTGCGCT GACTTTTTGA CTTTTCAACT CTGGCTTAAT TGCCCA