Vienna Tile Information
VT ID VT029515
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204785
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 229515
Nearest Genes
Gene Nr FlyBase ID Distance
CG5638 FBgn0036260 2868 bp
Sequence Length 2166
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TTGTCTTTTCTCCGGGGGCTTTCAC
Right Primer CACACAAAACATCACTTATAACCCTTTTTGGA
Template genomic
Sequence TTGTCTTTTC TCCGGGGGCT TTCACAAAAG GGTAGTAGTA GCACTTTTTG TTTTCACTTT CATTCCGACT GAATGCCAAC CGAAATTTCG TTGAAAATCG AATAGCAGGG ACATACGCAA CTGAAGCCAA CCTGTTATTC CATTGGCAAT AAATCATGCA AATAGGAAGT TGTTTCCTTT CCGGCACAAA TTTGTCAGCT TTTTTGGCTG CCAAAGAGCT TACAGCTTTT TTGAAATGGG CACAGGATAC CTTCGAATGC TCGTTAAAAG TACCAAGTTA GCAAGATTTA AAAGTGTATG TCCTTTATCA GCATGAAATC AACAAGGGAC AGGACATGAA ACATCTATAC GTATGGCAGT AATCATGATT TTAATAACAC GCATTTTTGT TTGGTTGCTA TATTGCATAT CAAATTACAC GACTTATTTG CTTAGATATT CGCTTTTACT AAATGCCACA AGTTGCACAA ATGTAATTAA ACAATTGTTT TCGCTTTTGT TAGGTGGCAT GTTTAAAGTT ATTATTATTC AGTAAATCTG TCACACCCCT TTTTAAATTC AAAATTTAAA TGTATATGTA TATTATTTTT TGTATCCTGT ATAATTTAAA ATAATATTAG TTTCAACGCA ACGATTGCTT TATTAAATTA AAACTGCTTT CACCAAAAAG CTGCGCAATG TTATTAAATT TCATGTATAT TTTTATTTAT TTACGTTTCG ATAAATCTGG CAAAAATGTT GAATACTAAG GCACACATCT TGAATATTGC ATCACTGCAT CAGTTTTTGA GCTCAAGATA AATCCTCTTA TCCGCTTTAG AACCACTCAT GAGTATTTTT GTATAAAGTG CTCACTTTCA ACACCGATGG ATTGATTAAG TAACTGGGCA ACCTGTTGAA TGTTGAGATG TTCATCCATC ATTTTTGCAA TTTCGTATCA ATTACTATAT TTAGAAAGGT TCCATATTAT ACATATAGGT ATAAACTTTT CAATGGCAAA TACAATTTAG ATATCAAAAG CGTTTTTGCT TTTTGTTATA TTCGAAATTA GCGTACCGTA TGAAATTCAT ACTATGCTTT TCAGAAACCG ATTAGGCCAA TTGAGTGTCA TTCAGGATCT TCAAAGGACC CAGCTGAGCA GAGAAAGAGA GAGAGAAACG AAGAGCTGTT AGCCTCTTGT TCGCCGTTCT TTGATGAAAT GCGCAGGCAG GCGTGACTTG TTTGTGCCCA TTCTACATTC ATTCGATTAG GCCAGGTCCT CTTGACGGCC AACGGGCTGG GCCGACTTCT GCGATTCAAA CACCCCCATG CACACCACAA TACACCCCAC ACTACATCCA CTATCAGCCC CAAATGCGAC AAGGCCGTTC ACTAGTGAGC ACTACTAAAC AAAAACGGAA CCCATCACTT AGACTCGTAT TTTTACAAAG CGGATATGCG CGATTTTTTG CTCTTCTGCA TTTTGTTATT TATTTTTGCT GTTTTTTTTT TGCTGTATGC ACAGATGCAT TTTGTTCCTT TTATTTAGCC GCCACAATTT CATCCGCTCT CAAAATTTAA TTACGAGTGG AAATGGCTTA AAGTGCTCAG TTCTGTTCTG TTCGTTGCAG TTTGGTTTTT ATCCTGCGGC AATGGAAGCC GCGGGATGAT TGCGCGGATA CAATTATCCA GCCACTCGGG TGAAATGGGC GGGAAAACGC TACAACGGCA GCGAAAAAGA GCATGAAAAC AATTTATTAA AATTAAGTTT CAATTTGAGC TGGTTTTTTG TATTTTTAAT TCACCGGAAG AAGCTGCCAC AATAATCATA TTGCGAGTTT TTGCCATTTT TGGTAGGCAG AGCAACGGGA GCATAATTCA AACGAAACAT GCTTGGCAAA TAGTTTATCA TTTGGGCTTA AATTAGTTTC ATTCTTTAGC CGCCTTTCTG CGAATTTTTT ATGTAATAAA CTTCAGGCAA GCTCAAAACT TTTATAGCAA GTGCACTTAA TTAAATGTAA GCTATTTCAA AATATATATT TTGGAACTGG AAGATCAGCA TGAACGTTAA AATTGATGTA ATATATGCGA TTTACTATAG ACTTTTTAAG GTATACCATT GCCTTAGTTT ACAAACCTTA AATCCTCATA GATATCCAAA AAGGGTTATA AGTGATGTTT TGTGTG