Vienna Tile Information
VT ID VT062636
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204759
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 262636
Nearest Genes
Gene Nr FlyBase ID Distance
CG9908 FBgn0000459 16131 bp
CR32914 FBgn0003933 19178 bp
Sequence Length 2077
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GACCCGCTCACTTCCGCTTTTCTT
Right Primer CATAGATTTCTGCCCCACCGCGATT
Template genomic
Sequence GACCCGCTCA CTTCCGCTTT TCTTAGTCGA CGGGAAAAAT TATAACAATT TTGTAACCAA ACTCGGGCGA AATTTCCTTT TGGGAATTCA TAAGCAGAAT ATTCAGAATA TATACTATAT ATATATATAT ATATAAACAG CGATGGGTTG GGGGTTTTTT TCTGGTTTCT GAGACACGGA GACGACAGAA AGGGTTGCGC TATTCTATTA TGTTATTCTA CGGCTGTTTC CTACCGCCTG TATCTAATTT GGCCATATTA TGAATTTAAC CCTTTCGTGT TTGCTGGATA TTTAAACAAC TGTTTGCACA AAAGTTTAGC CTAGAAGGTC GTCGCTGCCG GCAGTCGTAA CGGTAACGTT AACGGTAACG CAGCTTCCTC ATAATTTCCC CCCCTCCCAC CGCTGGCCAA AACCCCCTAA ATTGATTCTA CGTAATGCGT AGAGACAACC CATCCCCATC CCCATTCTCA TTCCCATCCT CATCCAGTGG CTGGAGCTTA GACCACCACC CCATTTTACT GTCTGGTGAT TCAACTTTAG CTTCTGTCTG CCAGAAAGTG AACTTTGCTT TTGGCCTTAC TTTTGCTTAC TTTACTTACA CTGGCAGAAA AGGCGACGCA CTTGTGCAAA ACATGAAAGA ATATTTATTT CATGTCTTAA ATGAAACAAC TAACTGCTGT TACATTGATG GGAAATCTAA TGGGAAAACT AAATATACAA ATTGGCTTGC ATTTTTTTAA AAAGAAAAGT AATAAAATCT GTTGAAATTG TTAATGTATC TAATTTGTTG GTTTCTAGTA GTTTTAATAT GTTTAATAAA ATAAACATAT TTCGAAAATA AAATATATAC GTATGGCTTC CAACTATTAT AACCCACTTA CGCCCAAGTT TGTCTAAAGT TTATTAATTA AACGCTTGTG GCTTCGTGTG TGGTTGAATA TCGCCAAAAA TTATATATTT ATTTTGTTTC GCTGTATTAA TGGGTTGACT GCGATTGCGA TTGCGACCCA TTACCGTGGG GTATTCGAGC GGTGTTTTCA TTTACTGGGC CTGTGTCTTC GTCGAACTCT TGCTTTGTTC TTCGCCGGAG ACCTCCATTT GCCAGGATGT CTTGGCTGTG GATGTGAACC TCGATGTGGA TGTGGATACT CGATGCTGGA TGTGTCGCTG TTGCTCCTTT CTGGTGCTCC GCTGCTGCTG CTGCTGCTGC TGCTTGCTCC TTTGGCAGTT CGCGACTTAC GACTGCTAAT GATGCCTTTT CCAGCAATTT AATTGTTAAA CAATGAAAAC GCTTTTGATT ACAAGAAAAA CAAGGGGCAA CCATCTGGGG TTTTGGGTTC CGGGTTCCGG GGCTCGGGCT CCTTTTGTTT TGCTTCGGTT TTGCGCCCCA TTCCATTCGA TGCGATTCCA TTCAGAAGGA GGCGGGGCGA TATTGTCTTT GCCTCCCGCG GCAATTTCAC AACGCAAAGG ATGCAGGACG CAGGACGAAG GACGAAGGAG TTACTGGAAT GGACCCACGG ACGGAAGGAT GTTTATTAAT TTTTACCTGA GGTTATCTAT TTGTCGCGCT ATGCTCTGCG TTCAGCCCTT TTTTTGGGGT TGAACCGCGC CGAGATGCTG GAAAATGCCT AAAAGGGGGA AAAGTGGAAA AAGAAAAAAA AAAAAATTAA CGAAAATATG AAATTATAAA ATGGTAGCGT TGCTGGCGTC GTTTTCGCTG CCCCGCAATT TTCATGCTCA TTAAATAATT TCTACTCATG AAAGTTCCTC CTGGCCCCAA AGTAGTAGAC CCCCATCCAA TCCACCATCT GGATATCCAT CCGCGCTGTT CAGAGGACCA GAATCAGAGA AGTATCATAG AAGCATCTTT CTGAATGGCT GGGGGTCGAC TATGCGGCAC AGAAAGGTGG GCGTTAAAAA GTTTTTATTG AAAGTTGTAA TTTAAATTTA TTAGGTTTCA CATTTTAATT AATGCACACT TCTGCGTCCC AGCCTCGTTG CCGTGTTATG GGTTGTAAAA AAAAATAAAA AAAAAACAAA TTATAAAGTC GGAATCGCGG TGGGGCAGAA ATCTATG