Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT007402
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204674
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 207402
Nearest Genes
Gene Nr FlyBase ID Distance
CG4491 FBgn0005771 3640 bp
CG15283 FBgn0028844 34269 bp
Sequence Length 2140
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer CCAGAAAGATCCATCCGAAGCACAA
Right Primer TGGAACAATGGACACACACACAAAAA
Template genomic
Sequence CCAGAAAGAT CCATCCGAAG CACAAGAGAT ATATATGCAT GTATAAACGT ATAAACCAAC CGACCGACAG ACGTCGCCGA CCCACACACT ATTTAATTTA GTACAAAATT ATTATGCGCA ACATTAGCAC TCGTCTCGGT TTGCCTGGGT TTTCCTCTCG GCTTGGGTTT TTATCGAGTC TGGGTTTTGG GCATGGGTCT TTTCTCGAGT TCGGAGCGTG AGGTGCCTCA AATGAGGTGT GAATTTCGCT GTCAGCCCGT CATTCTCAAC GGACTGAGGA GAACACACAA AAGTGCCGAC ATTGGTGCTT CTTCTGTGTC GGTTTTGAAT TTATGTTAAT ACAGTCGCGC TTTGAAGCCA GCGTAACGTT GAGCATCGCA ATTGTCTCAA TACCCTCGGA GTATTCAAAT TAATCGGCAT AGTCTCTTAT AATAAATAGC AGTGCGCATC TGCAAGTCTG AAAACATATT AAACACCCAA AAGTTCATTC ATTATTAATA ATCTTTTTCC CTTTTTTCCG TACCTTGGCT CACATGGATC TATTATAAAA CAATGCATCA TAAGCTGTGC TCTTACGTTA CGGTTTGTCT AAAAATATGT ATTCACAACG CTTGCCATTC CATATATCAT AATCGAACAG AACGAGCAGA GGAAAACATT TGCAAGGCAC CCAGCGAGCA TCAGCAGAAC AACAAACAAA ATATTTATGG CCAAACATAA AAATCTTTAT GACCTTCCCG ATTCAATCAG AGCAGAGCTG GAGCTGGGCG AGCACAACAA CTGAGCCAGG TCCCAATGCG ACTACAGCTA CAACGACTGG CGCTTCCTGG CGAACACAGG ATATAGCCAT CCATAAGGTG TTTCCCCCCG GCCAACTCGC CCTGCCGCCC TGCCGCCCAT GTGTGTTCGC CTTGATAAAG AGAACGTAAA TTATGGCCCT ATATATCATG GGAAATCTAT CGACAACGTT GAATTTTTAT GGTCTCCGAA GGAACGGCGC AGTTTAACGA GCCGGCGAGA GTCTGGCCAT GTTTATTGAT TTACTCGCTA ATTTTTCAGC TCCGGCAAAG ACGGCCGAGG AGTGCGGTCA ATCAAGGACA TCCGAGGACT GGCCCGGGCT GAGATGAGAG TCGATCGCGG CAGGCAGGCC ATTGTCCTTG ATTTATGGTC CGTCATTCAT TGCCAGCCAC CAAAGTTGAC ACTTCTGCGT ATATCCCGGA GTTCGTCCTG CCATTGTCAT CCAGTCACTC CCCTCGATGT CGTCGTCCTG CGTCCTTCGA CGTCCCTCCC GTTGCGCTCA TCCTGACATT TTGACAAATA ATTTTATTGA TGCTCTGTTC CTCGCCGTCT GTGTTTGGTT TTTAATTGTC GCTCAGCTGC GCTGGACGCA CGTGATAATT GCTCATTTTA TGACGCATTT ATCAAATGCT CGGCCTTGGT CTCGTCCTTG GCATTGGCAT CGGCATCGGC ATTCGGAATG TCCTTTGTTC GGTGGTGATT TTCTGCATCA TGCTGCGTCT GACAGTTGGA CTAGCGTACT CCTCCTGTTC CTCTTCTACC TTCCCCTTCA ATCCTCCGCA GATGAGACAG TCACGCGTCA TTTATTTGGC CGTGACATTT CCACTCCGGG TTGCCATTTT GCATTCGCGG GAATTAGGAA TGGATTTGGA AAAACTGTCC GAACTCTTCG GTTCAAGTAC ATTCAATTCT GCATTCAGCA GATGGTGCTA TGAGCTATCA AAATCAATAA GCTGTGAAAC TAGATGGAAA TTGTATGCTT TTTAAAATAT TATTAATGTA AAGGTTATTT GTATAAAGAC AAATATTTAC CATTCCTAGA ACTTTCTTCA TCATCCGTAC AACTTTTAAA ATCTATATTT CCTTCGAATA AATAATCTAT TCTCATAGAT GAACTTTTCG TGATTTATTT GTTGGATTAA ACCTTTATCA ATAACCGCCG TATATCAACA GGACATCTCC GCCCTCTGGA CCCACAGCCG TCAGATCGGA TGTTGTAGGC AATTAATACT TAATACCCAA AATGGCAATA AAAATTGATG CCATCAATTT ATCATTTTAG AATCCTGCAC GTGTCAACTC GTAGGTATTT CCACTTTTTG TGTGTGTGTC CATTGTTCCA