Vienna Tile Information
VT ID VT026149
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204563
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 226149
Nearest Genes
Gene Nr FlyBase ID Distance
CG34418 FBgn0085447 0 bp
CG10583 FBgn0035627 5487 bp
Sequence Length 2177
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGACCCTATGAGCACTGTTTAAATGGAGAA
Right Primer TGCGAAATATTTAATTCGTGATTGGCATAAA
Template genomic
Sequence TGACCCTATG AGCACTGTTT AAATGGAGAA ATTAATATAT AATGTATCTG AAGATAGTTA CCTAAAAACG AATAACCTCT TTCCATCTTT TGCAGCGATC GAGTCGCTAC CACAACCATC GGCACAACCA GCGGTCACAG TCGCTGAATC GCGGACAGGC GCTCTCGCAG GCGGACGTGA GCGGCATGTG GTGACATCGG GGTGCCTCTG GTAAAGGTGA GCTCATGTTC CGTGCCCGAA CCCGGACAGA AACTAATAAC AAACTAATAC ATCCTGCAGG ATCTGCGGCA AGCTGCGCCA ACTGCGCCAT GGGTAACAAA CTGAGCTGCT CCTGTGCCCC GCTGATGCGC AAGGCCTATC GCTATGAGGA TTCGCCCTGG CAAAGTTCCC GTCGTCGCGA TGGCCATCTA TTGAGGTGGG TTATGGTCCT AACTTTCGGA ACAGAACCAC TACTTTATGT TAACTGCTGA CTGCCGAAAA CGAGGGCTCC AACCACCAAC GCCACTACCA ACAACTGAAC CACAATTGAA TTCGCTCTTT CGATAGCTTG TTTCAAACCA ACTAATTGTT TCTTCTTCTG GTTTTTCTTT CTTTCACAAA AAAAAAAAAA AAACAAAACA ATTTACCAAC TTACGACCAA ATCAAAACAA ATATACACCT GAAACCACAA AAAAAAAACA CAAACTGATG CGGCCAAACC TCCAAACCAC CACAACAACT ACAAATGTAT CCTGCTTCAA CTTTTCCTTC CTACCTCCGA CTGCAACTAC AACTACAACA ACTATAACAA CAAAATGTGT TCCTTTGTTT GTTTTTACCA ATATTCTCCC CTCCAACCCG AAAACTAAAA TGTAACAATT GTGCACCAAA TCCAAATCCA AATTCGTATC GGAATCGAAT CTCGAAACGA CCCAACTAAA AACCAACTAC CATCCATTGC TGTAACTTAA TTAACCAACA ATAGTTCGTT CAGGTTGTGG GCAGAGGTCT TCCATGTATC AGCGAGCGGA GCCGGCACCG TCAAATGGCA ACAAGTGTCC GAGGATTTGG TTCCTGTTAA CATCACCTGC ATTCAGGACT CGCCCGAGTG CATCTTTCAC ATCACCGCGT ACAACAGTCA GGTGGACAAG ATACTCGACG TGAGACTTGT GCAGCCAGGT GAGTGCACAT TGATTGGGCG CCAATTCCGT GATTAACTTA TTCGATCATC CCCAACCGAA TACCACCCCT TTTCTAGGCA CACGCATTGG CCAGGCATCG GAGTGTTTCG TTTACTGGAA GGATCCCATG ACCAACGACA CCTGGGGCCT CAACTTCACC TCGCCCATCG ATGCCAAGCA ATTCCGCGAG TGCTGTGTAA GTATTCTCTT ACGGTCTGGC AAAGCAAACA TTTTCGCATA GCGACGACAA CAACAACCAT GCCAAAACCC AAAAAAAAAA TATATATTTG AAAAACAAAA AACAGCCAAA AGAAAAAAGA AAAAAAATAT ATATAAATAT ATACCTTTAT ATGAAAATTA ATTCAAAACC AACCTCAACT GATACCGATA CCGAAAAAAT GAACCTCAGC CACCCCCACA ACTAATACAG CAAACACACT AACAGAGTTC GGGCGGCGAG CTATAATCAT GCCCGCCAGC TGGAGCACTT CAGCTGAGCC ACCCACCCCG AACCACTGCC AAAGCCAGAA CCACCAGAAC CACCAGAACC ACCAGTACCA CCAGAACCAC CAGTACCACC AGAACCACCG ACCCAACCAC CCACAAAACA CTCATGACAC TCACTCACAC ACACACAGAG ACTAAGACTA GAAAACACTG AGAGAACCGA GGTGGTGACC AAGATGGTGA CGATTAAAAT GATAACGATT ATGATTATGA TGTTGCTGCT GCCGCTGACG ACGATAATAA TGATAATGAT AATGATAATA ATAATGATTA TGATGGTTAC GAGCCAGTTG ATGTTTGCTT TGCATATAAA ACCCATCTAT CTAGCTGCTA TGTACTCCAA ATATTCATCA CCAATCTCAA GGTTCAGTGC CGCAAACACT CGAACAATCT GAAGATGATA TCATAATTAA GCTCTTCATT CGCTCACTAT CACCGCCGAG TCACGGTCAC TGTCATAGTC ACAGTCACGA ACTACATTTA TGCCAATCAC GAATTAAATA TTTCGCA