Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT008424
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204455
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 208424
Nearest Genes
Gene Nr FlyBase ID Distance
CG4952 FBgn0005677 10334 bp
Sequence Length 2219
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCCTTGAGCATCTGACTTTCGGGAC
Right Primer TCAAGTTTGTTCATTTTCCACTTTAAGCTCTC
Template genomic
Sequence GCCTTGAGCA TCTGACTTTC GGGACGGGCG TGCAATCCGT GGGGCGGCAT TCCCGGCGAC ATGAGAGCCG CCGCTCCCGG ATGGTGGGCG TTCATCTGCA TAAAGGCCAT GTGATTGATG GGCGGCGGAT TGTAGCCATT GGCCAAAAGT GGCGATTTCA TATCTGGTAA ACATAAAAAA TTTAAAAATT AAGTTATGCT AATCCGTTCT ATACTTTGCT TAACTAATAT ATTTTTCTAG ACAGTACCAT TCCATTATTT AAATTTTAAA CCATTTTACT TTAATTTGTA TTAGCCACAT TTACTTGGCA GTTTAACGTT AATCAATACT TCATGCCTCT GTCCTGAGCT CTGCTAAATA TTTTAATTTC GAAATACATA TTCACTCGTC CATTGGCCCA TCCTCGCCAA TATTTGCCTT TCATTTTGAT GGCTCGCCCA ACTGACACCT GTTCTTGTCT GTATCTGCCA CATATAAATT TTATACTGTA TACATATATA TACATATATA TATATACCTA TACATGGCCT GTCTATTGTC TGAGCGGCCA GACTAAACAC AACAACTAAA TGCACCCACA CACACACGGC AAATATACAG ATGCTTTTCT ATCTGGCGTG TGTATCTACG GCTGTCATTT GTTTGCACTA TGTACATATA CATGTATGTA TATGCTGTCA TGTGTACTAT ATGACTATAT GCATTTAGAC AATTTAGTGG GCCATTAAAT GCTTTAAAAT TCACTAAAGT GCTAAAATTG TAAGTTGGCG AAAATCCGTT GGCTTCGGAA TGCAATTAAA CGATGGTCGT TCGTATGTGA AAATGCAGTT AAAAATTTAG AGAAATGCCT TGTGCACTTT TTATTAATAA TGCAATATCA CTCAAGTATC AACGCCCCAT AATTCACTTC AGGCAACCTT TTCTTTATGG CCATAAATGA CGGGGCGAAA AAGAGCAAAC AGTTCTTCAG ACCCATCTTC GTTTCAGAAG GCGCCGGCGG CGCATGGTTC TAAAGAAAAA GATTTTGAGA TTTCATTCGA TTGGGCTTTT TGTGGCTGTT CGGGTATCTT TCAATATTAT GCGTTTCGGA CACATTAATA GAAAGAGGCG TGGACGAAGT TGTCAGCTCG GCACTCTCTC TCCTTCTAGC GATCATAGAG AAATATGTAA AAAAAAAAAT CAATTAAATA TAAGTCCGCT TGTACTTATC ATAATTACAG ACACAGATAC AATTCGAAAA TTCAGTTGAA TGCGATTTCC TGTGCCAGTA CAAATCACAG TGTGGAATTC GACTTGATTG TGGCTTTGGC TGCCATTTAT CTGTGGTGTG GTGGTGGCTC TGGCTTTAGC TTTGGCTGGG AACGTAGCCA AAGTATCTGT ATCTGTGCCT GTGTATCCGT TTCGTTTTTG TCCGTTTGGC TGTGCTGTGT AAGCTGTAAT CAGCCAACAA GCAGCGACCA CAAATCACAA ATGGCGGCAG CGACGATCAT CGATCGACGG GCTGGGGAAG CACAGAAATA CAGAAACTCA ACAGCCGCCG ATCCCCGAAA GCGAGTTATG TGGCCAATCT GGGAATGATT TCATTACAAT TCGAATCCGA ATTCGTGGCC CCTGCGGCCA TGCCACTCAA TTGTGTGAGA ATTGCAATTG GCAGCGGCAA GTGGGAACTT GAAGTGCACG GTAAAAATAG TGGTAGTAGC TGTCCACTTG AATGTTGAAT GTTAATGTTA TGTATGTCAT AAGAAAAATC TCCAAAATTA TACTTGTTTT TCTACATGAA TGTCACACTG GGTAGTTCGT AATGTATGGT CACACCAATA TAGATTATAT TCAATTACTC ACCACTTATG TGCCCATTTT CATAGGCATA ATCGCCGTTG TCCAGGCGAT GCTTCTTCAA CTGCGGATGC TGCGATAGAT GAGTGGGCGG CAGGGAAAGC CCAACGGGTC CCCTTTTGGG CGGTCTACCC GGTCTGGAAC TGCGGAATTG CAGAGAGTTA CTGTTGGGTT GAGAGCAATG GACAATATCC GTGGTATCAG TACAAAAAAA TGCCAAATGC CTCAGCACAG TGATCGCAAT TCAGCAAATT TACGGGTGGG ATTTAGTAAT GTAGAACAAA TGCTTATTTT GGCATTGTGC TGCTGCATTT TCACGTTTAT TATTAGATAT ATTAGATAAC ACAACTTGAG AGCTTAAAGT GGAAAATGAA CAAACTTGA