Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000108
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204425
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200108
Nearest Genes
Gene Nr FlyBase ID Distance
CG3696 FBgn0086902 4955 bp
Sequence Length 2096
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ATGTGGAGTGCCTGACATGGGCTAA
Right Primer TTTGCTCTGCTTATTCTTCGCCAGC
Template genomic
Sequence ATGTGGAGTG CCTGACATGG GCTAAGCGGC GGGCTTAACA CCGCCCACCC CCCACCAAAC TATTTGCCTC CCGCACTCAC CTACCCTCGC CGGGACTGGC CCCTTTGTGG GTTTGCCGTG AGTAGTTCGC GCTTATTGGA CAATCATTTA ACCAGTCGTC GTCCCCTCTA CACCCTAAGA AATCCATAGG TAACTAGTTT TGATAAAAAT CTCAAAACAA GACCATTTGC GGTCCGAGTT GTATTAAAAA TAATTAAAAC TACAAAAAAT ATTTTTATTT GTATTTAACA TTCATCTTAT CGTCCTGCCA GGCAGTAAAT ATGTAAAATC AGTGCAGTGC AAATTTTTCT TGCAGTGCCA AATTGTGTTG GTTCCCTCCA GGTGCTTTGA CTTTGCCGTA ATCAATTACA TTTTGCTTTT GCAATTTCAG CTATTTATTT ATTTAGTTTC AGCTCTTGCC ATTATTATTA GGTGAGTGGT ATGTATGTAT GTACATACAC AGGCCCGTTT AGCTCCATGG TAATGGTGTG GCTGTGCGGC GCGACTTTAC TGTGTATATC TGGCAGATAT CTATCAGTAT CAGTGAGTGG TAAGTGTGGT AAGTGTGGTG TGTGTGTCGC ATTTTTCCTT CTTTCGCTTT AGTTTTCACT TCTTGCCCGC TTCTTCCCAT TTTTTGGCGT GGCTGTTTTT ACACAAACAA ATCGGGCATA GTAATTGCAA AAACAACAAA CTAAAAGCAA TAGTATCATA CATATGTATG TACAAGTGTT ACATACATAC ATACATACGC GCAGTCCGCG TTTGGGTAAG CAAAGCAGAC ATCTGAAAAA TTGTGAAATT ATACTTTACT TATTGCCTCT CTCCGTCCAC TCTCCTACGG CACTGTCTGT GTTTATGTTC ATGTCTGCGT CTATGTCGTT TTGTGTCTCT GCGCACAACT GTACGTTTGT TTTAAATAAG CGAAAAATCG ATTAAAGGTG ATAATAGACA AGCAAATTTC AGTGTGTCCA ACGACAAAGA CGCGAGCCAC ATTTTTGTGA CCCGACGATG ACTACACCAC CAACAATCCG ATCCAATCCA ATCCGACAAA CGAACAGCAC AGCGCCACCA CCATCACAAC GCTGGATTAG CTTTGCGTTT GGGCCGGGTC TGTCTCTGCT TCTTCTGATT CTGCCTTCCC ATGCTCCCCC ACGTTATGAG CCATGAAAAT CGCCCCCAAA AGAGTTTACT CAAGTCACAC ATTTCTCGCC GTTAGAAAAG TGTTTCTCGT CGGTTGGCAT CAACGTAAAC AAGCGCTTTG TACGCACCAC TTTTGGGGGC AAAAGGCTCA AAATACATTT TTTTAAATAG GATTAATACC GCAGCACAAA TATCTAACTA TTATTTCTCC CAAAGCTGTA CGAATCGAAT CAAATAAACC TGAATGAATA TTTCTCAAAC TTATTTTGCA ATAGCAACAA TAAAACACAA AAAACGAGGA GAGGGTTCGT TCACCTTTCG TCGTGGGCAA ATGTATTTAG TTAACTCACA ATTTTAACAG TTGCTTTGTG CTCTTGCTTC GCCTTTAGGG CCGACTTTGC CAGCTCTTTT ATCTTCAACT TTTTAAATGA TGCTTTAACT TTTCAAATGA CCCACAGTCC TTCAGCGGCT GCAGCCGTGC GGTAAGAGTG AGAGTATTTA AAAAAAAATC CCTTTTTAAC CCAGCCCAAT AACGACATCT AAAAAAACAA AGTATTGTTC ACACATAATG CACACTTTAC GTTTTGCGGT GCTGTGCACA GTTGTGTTTG CAAAGTGTCG TCACATAATA AAAACTCACA AACTTGATGG GAGGATGCAT ATATGAACGT ATATGGTAGA AATGTATGCA TGTATGCATG TGAACGAATG AATCTGGGTT TAATAACAAT CAAGTCAAGT GGCTGTGTCC GCGCTAACAG TAACTAAAAA GTACAGTTGG TTTTTGTAAG AAAAGCCACA TTCAACAGCG GCACCCAAGT CCGTCACTTA GCGCGGTCCA AACAGAGCCG AAGAGCGGCT GAAGCAAGAG AATTAGGGTA GAGTGGGGGG CGCTGGCGAA GAATAAGCAG AGCAAA