Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT058868
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204399
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 258868
Nearest Genes
Gene Nr FlyBase ID Distance
CG12154 FBgn0004102 4886 bp
Sequence Length 2098
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCCTGGATTAAATTCCCTTTGTCCTGT
Right Primer GCAGCGACTACCAGAAACTAGCAGCG
Template genomic
Sequence GCCTGGATTA AATTCCCTTT GTCCTGTTCT TCACTACTCT CGTCGGTTTT CGTGCGAAAA AAATTAGCAC TATTTGGACG GGGAAAGTAG GGAAAGAAAG TCCAAATAGT TTCAAAAAAA AAAAGAGAAG GTTGTAATTG CGGAATTAGC ACGAACACCT CTCGCATTGT TTTGAAATTG AATACCGCAC ATGGAATACG GAAAACGGAA CTATTTGTCA CATCAAGAGA GAAAGATATC CACATACGAT GAGTGTATGT AAAATTTGTT TTGTTTTGTC ATGTCGTTTT CATGGCTCAA TGCATTTTGG CCTCAAAATG CAGCCGCAAA TACATCGAGA TCCCGAGATG CGAAAAACAA AAAGCACCGA AACAGAAACA GAAACCCAAC CGAACCCGAC CCTGATATAG CACCCGATCC CCGATCCCCG ATGTGCGTTG ACAGACCCGG AGCCTGTTCC TCCTGCCCTT CGAATTGCCA AATTACATGC TCACGCGCAC ACGCAAATTA ATAACACATC TGGCTTCAAT TCGAGATTCG GCAGGGCAGC GATAAAAGAA AAAAAAAAAG AACACAGCGA AAGAGACAGC GAGAGATGTG CTCTATAAAG GATTCGCCCT TAACCATCCA CCAAAATGCC CGTTTCGGTT CGCTGCCCAT CTCGGGAATC CAACTAAACG GAAGCTGATC GAAACCAAAG CCATAATTGA TAGTTGCATT AAGTTGATTA AAGTAATAAT TAAATAATAG TAATAGCATT ATGATTATAT GCACAACAGG TTGTGATACC AGAATATAAA AAAAAAGTTA GCTAATCGCA ACTATTGAGC TATTAACAAG AAATAAAAAG GTGAGCTTAA ATAACCAAAC TAATCACGTT TGAGTTTTAA GCGAACTCTT TTTCTTATTT ACCCCATCCC ATTAAAGTTC CCATGGCTCT TATTTAACCA ACAACTTCCA TTAACCAAAA TTTTACAAAC GATCGAAGAA GGTAGAAATG TGAAATGTAG CTCCAAAAAA GAAAAAAGAA AAAACCTCGT CGTCAAACTC TCAGCATCTG TCAAAAAAAA AAACCGAATG TGACACATTT TCGAAAACAT CCCGGCAAAG AAATGGGTTG GAATATGGAA TGAAATGGCG ATCTACGGCA CTACGTGATT TTCTAGACAT TTCACAGCCC CCTTTGGCCT TCCGCCCTCG CTGATTATGA AAAATCATGG TAAATGGCAA AAAGAGCAAA ATAAAAAATA AAAAAAAAAG AAAACAAGAA GGCCCCGCTG GCACTTTTTT CATTTTTTTT TTTTTTTTTT GAAGAGATCC ATTGTGAGGC CGAAACGAGT CGAGACAAAA TCATTTGGGC TGGACATATA TCACGTACGA ACGGCGGACA CTTTCATTAT AAATTCCATT CGGCATTTTC ATGATTTTCG GTTCGGTACG ATCTTCTGAT TTGCTCCATT CTCAGCGAAT GTTTTTCAAT TTTCACTCTC GATTTCTATA TCTACTCCCA TTTCCGCCGC CTCACAAACA TTTCAATTCG TTTGTCCGCG CGTAATTACG GTCAAAATAA TATTTATTGG ACAAACAGCC GGGAGGAAAA CAAAATAAAG CCCAGAGATT CAGCGATGCT ACCGTAAGAT TTTGGGGGTT TTTAGAGATT TTCTAGAGTG CTGTAATGGA GAGATGGGGG GGGATGGGGG GTACTGAACC CTTTATAAGC CCGCACATCC AAGTGTTTTG GTTCGCTGAT GATCCGACTG ACGGTCCCTG GGAAAGTCGA AGAGTTCAAG ATTCGAATAG AAATCGAACT GCCACTTGGC TACTGTTCAT TTGGGCCATG GGAATTGTGG ATCTCCACGC CGTTTGCCCG TTTGATTAAT GGTCCGTCTT TGCATAACTT TCGGTCTACG CATTTGGCTC TGACTAATAT GAAATATTAA ATGCCGTCTC GGCGATCGCA TATTTATATC TATATTTAAA TTTAGTCAGT CGGGCATACA GCGGTGTGCA GCTGTCAGGA GTGCTAACCT GTCAGTCGCC GGATCGCAGT TAGTATTAGT AGTAGTAGTA ATCGCTGCTA GTTTCTGGTA GTCGCTGC