Vienna Tile Information
VT ID VT028507
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204314
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 228507
Nearest Genes
Gene Nr FlyBase ID Distance
CG6577 FBgn0011569 4798 bp
CG14156 FBgn0036078 15461 bp
Sequence Length 2149
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCATTCCGTAGATATTTTTCCTACCATACCC
Right Primer CTGAAGGACTGCGGGCTGACAAGAT
Template genomic
Sequence CCATTCCGTA GATATTTTTC CTACCATACC CTGCAATTGA AATTCAAAGT GCGTACTCGC ACTCCAAATT AAATTAACCC AACCGATACT TTTCTGTCTT AACTGTGCAC TGGGATCTTG TTAAGCAGCT TCGATGTGAA AGGCGATCGC GATCCTTTCA ACGCTGTTTT GGAAAGGATC TGTCTGAGGT CTGAGTTCCT GCTTATCCGC GGCGTCATTA AATTCATTAA AAGTGCATCA AAATGTATCG CAGAGGACGT GTAATTTTCA TGTAATCCAT CAGCGTGCAG CCATTGACAC CCAGAGGGCC CTTCACTCGA CAGGTAATTT TTAGGTATAT TTTATATACA AAAATTATGA ATTACAATGT GCGCCGCAAC ATGTTAATAA GATGAAGTAC GTGAATATGC ACTTTCGGGC TGGCAAATTC AATTAGGCGG AACGATCCAA GACACTCATG TGCGATAAGT GGCCGCCACA AAAGCCGCAA AGCCAGTCGA GTCCTATGTC CTAGTATATA GCTTATCCTC TTCCGATCTG CGGTTAAATT CGCAAGTTGC AGTTGCAGCT GCAGATTCAT TGTGTGCGAA ACGAGTCGAA TGCGTAATTT AATAAACTCA CGAGGGCAAC TAGGAGCAGG TTCAGGACAT TTGCGACGCC TGCGAGCCAT TCGGTTGAAA ACTAGTTGGT GGCGCAACTT TAATCCCGCA TCGCATTTGC GTAATAAAAG TTTCAACTTT ATTGTTAATT AAATTGCCAG GACATGTCGT GGTCGTTCTC GTAGTCTTGG TCCTTGTTCA GATCGTGTGG CCCAGAGGCC TCTTGACAAC GCAGCTGCCT TTTTTGGGCC ACGTCTATCA ATGTAAACGT GATCTGGCCA TAGCCCGAAA GTGTGGAAAT TATAATAAAT TTAGCCGCAT TTGGCCCGCA GTTTCTGCTG GCCGTAATTA TGCAGACACC TTGCCAGCCT TTCGATCTCC ACTCAAAATT GGCCAAGTGA GCTGCAATTG CATATTGCCA TATTGACAGC GTGATGGATG TTTGGATCCC AAGTAGTTAT ACGCCGAATC GAAATCGATT GAGCTGCTCG CTCTGCAAAA GGAGGCTTTG CATGTATGGA AAATAAAGCA CTGAAGAAAA AATCATTGAC TTAAAGATAT CTGTTGGTTA TTTTAGGGAA ATATATATTT ATACTACATT ATATATTAGT CAAAATTCCT AATTCCTAAA AAAAGATACA AGGTTTTTGT TAAGGATTTA CCCAACAATT TATGCAGGAG CCTTTCGCAT CCTTTTTTTA TTCGAGTGCA CATACTGCCA CGGGTGGTCC GCCGTCAAGT GGCTGGACAT TAAGATTCGA CCGGCGACTA CCGTTGGCCA TTTAAGACAA TAAATTTCAT AAATAGCTTA TGCATAAAAT GCAGTCGGTG GCCCCTTACC CATTCTACTG GCCACTCGAT TCGAACGTGG CTCTCAACTC CCGCTGCGTT GATATTAATT GGACGACATA ATTGCGGAGC CACGTTGGCC GTAATAATGC GGAGTGCGGT TCGTGGGGTA ATTGCTCTGG AAACACGTTC CACTGGCAGC ACTCCCCAAT CGAAGCGAAC TACCGGAGTT GGAATTTGTA TAAATATAAA TTTTGGCTAA CATCGAGGGT CCTCTGCCCG AACTGCGTAA TTATGGGTTT TGTGGCACTT GGCTTTTGCA TCGCTGCCTT TTTGGCGGCA CACACTTGAA ATTATCGGTG TGTGTCCGCC ATTTAATTTA TTGTCTTTGG CGCTGCCCTA AATCCAATTG TAATACAATC CGCCGCATTT ATCATATTTA ACAACCGACT CCAAACGCAC ACACATCCTG TATTTAACGG CCTGCTAATA CGCGGTTTAA GTTTAATGAG TGCAAAGGAA GGGGTCGCTT ATGGCGCGTC ATAAAAGGTT GCAAGTAAAG TTATGTTGCA ATCAAATAAG AATTTTTAAA TTTACCTAAA CTTGCCCTTT GCCACTGCGA GAACTGTTTA TTTCAAGCCA ATCGATTGTG AAAATATTCA AATTTTACTA AAACTGAAAT ATTTGATATA ATAGCCTCAA TTTAATTTTG CATATTTTTG TTACCTTTGC GAGGATCTTG TCAGCCCGCA GTCCTTCAG