Vienna Tile Information
VT ID VT013975
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204274
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 213975
Nearest Genes
Gene Nr FlyBase ID Distance
CG2040 FBgn0010114 12627 bp
Sequence Length 2228
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGGAGCTATGTATCTGCAACTGCAACTAAG
Right Primer CGCTAGCGGATCAGGATCTAAAGGA
Template genomic
Sequence TGGAGCTATG TATCTGCAAC TGCAACTAAG TATTTGTGTG TATGTCAATA CTTCAATATT TGATGGTGCA TTGTCGTGGG CGTGAGTTGT TGCAGGCGGG AGTAGTTCAC TTACCCTCCT CGTTGGTGGC GCACAACGGA CCCACCCACT TGCCCTTGAC GCAACGGATC TTGCATAGCC GCCGATCGCC CATGGGTCCG ATTTCGCCCG GGAAGCGAAT CTCCGACACT TCGGTGAACT GCTGCAGGAT GTCGACCTCC TCGTCCTCCT CCTCCTCCTC GTCGAACTCC GGGTCATCTG GATGGATGGG CGTGTAGCCA GCCTCCTCGT CGTAGATACC TGGATATTCG AGGCGGGACG AGAAGAGCAG AAGGTGTGGG CGTCGTGAGA TGGGCAATGT ACCATGCCAA GAAACAGGGG AGGGGGTAGA TAGACGTTCA GAGGGGGATA GAGCAAATAG AGCAAGCATC TAATGAGCCG TTGAACGGCA TGCGAATGAA ATGCAGATGA AGATGCTGAT GCAGATGCAG ATGTAGATGA AGATGAGTAT GCTAATGAAG TGCCGGTGGA CAATGAGCGA TCTTAATGCC CATCCAAGTT GACCCAAAAC TCGACTCCAA GTTGCGCCAA AAGTGCGAAA GAGGCTGCAA AATCCTCAAG TACGCCCCTT GGGCACACAC ATTAAGCCAA GGAGAAGCCA TCGAGAAACC ACGAGACGTG CGAAAAGTGC TGCCAGCTGA AAACTTCAAT GGGCCGCTCC AAGTGCTTAG ATATGCATTA AAAGAAAACC AGAAGGCTGG CGAAGTGGCC ACTTAACAGG ATACAACTTC ATTTCCCAGA AACCCCATCA AAAGACGGCA CTAAAATAAG GGAGATGTGA AAAGGCAGAG ATAACACCAA AGATAATATT ATGCTGGCTA ATAGAAAATA GAAAAAAAAA GATGAATAAA GCAGTAAAGG ATGCCGAGAA GGACTCGGAC AAAGGAGCCC CAGCTGAAGC CCAAGGCAAA CAAAGGAGCC AAAAGGAAAA TCATTCCGGC CAGAACAAAG GGCCAAACGG CCAACCGGCA GCGGACAACT CTCAACTCTG AACTCTAACC ATGACAAAGA TATGGACTGG CAAATAAACC ATGACCACGC AGCACCGATG GCGGAAATGG GGTAATGAAA AGCCGTCGGA GAGGGTGGAA AATGCCAGAA CAGGTGGGCT TTTGGTGGCG TTTTGGGTGT TGGGTGAAGG TGTGATTTTG ATAGGGGGAT GAGCCATGGC TGGATAGGAT GCTATTGTTA GATGCGATGG CTGTGGCTTT GGCTGTGACT GCGATTAGCT TTTACGAGTA TGTTCGGTGT GTCATCCGCT CTCAACTTCC GTTAATGTTT GGGTGTTCGT GTGTACTCAT GTGTGCTGCT GTTGGCTGAA ATGCCCTTGC AAAAGCGTTT CAATACTCGC TGCTAGACAT TGTCAAAATG TTGCCACATT ATAAAGCTCG AGGGCATGAT GAGGCGGCGC CTAGGCTGCT GGCCAGCCGC TTGGGAGTCG TAGCTGGCAT GGGTTTCACT CTTCAATGGC TGGCTAACTG GTCGTATACT TAATTTTGCA TTTAAAAGGT ATAACTATTC AACTGTGCGT ATGCGTAATT TAAAAATTAT TGTATAGATA AAACCATTTA CATCCTGATG GTATATTTTA AAATATTAAT ATTATATTAA CACCAAGCTC TGGAAAATAT TAGTCATTTG AAGCATATTT AAATCGTCAA AAGATTTGAA AGTTAAAGAT GGTTTTTATT TTGTTAACCA ACAGTTAACA GGCGTGTTCT TGTAACGGAC CACTCCTGGA CTTGTACTGC CATTCGGCGA CCCTTCAACC TTTGCAAGGG ATTTCCGAGC GGATGATTCC GCCCTCCGTG AGATCTCTGC GAGATCGGAC AGCGCGACAC GGACGGACAG ACAGACAACG AGACAGCGAC AGCGACGGCA AATCAAGGCT TCAAAGGCAT TGGGCACTGT GGCATTGCCA GTGTCTGGCC GCCGTGCGGG CGCACACTCA CCCTTGTCCT TGCGACTGGT GGTCTTGGAG CTGGAGTCGC CACCACCCTT CGGACGGCTC AGTGCACCCG TGGTCTTGCC GGACTTGCGC TTAACACGTT GCCACAACAG GGCCACTCGT GCACTGCTCG ACTGATTTCC GTACTGCTGA AGATCCTTTA GATCCTGATC CGCTAGCG