Vienna Tile Information
VT ID VT040346
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204248
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 240346
Nearest Genes
Gene Nr FlyBase ID Distance
CR31197 FBgn0011905 415 bp
CG10095 FBgn0037993 24733 bp
Sequence Length 2094
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GAACAGGACTAAGGGCCGTGCTGC
Right Primer ACTGGCCTTCCCAATTCAACTTCCA
Template genomic
Sequence GAACAGGACT AAGGGCCGTG CTGCATGCAC ACAACATTTC TGAGATTCCA AAGTGGGTAA TCAGCTTTGA AAGACTTTTG TTTAAACGTT GCCAGTCGGT TTATAAATAA ACATAAATGT GGAGAACAAT AAAACAGGAA TAAGAAGTTG TGCACAGCAA CAAGGCTTTT CCTATTAATT ATGACTTTTA AAGTCATACA AAGCTTTTCT ACTGGTATAT CAAAACTTAA ACGGAAAATG GATTTATTTA TTTTATACGT ATTATTAGAA CAATCGATTT AAATGCTTCT GAATCTGCGG TCTTTTAAAA TTTACGTTAA AATTCCTTCG TTGCAAGTTA TCTGTGCGAA CTTAAAGCTA TAATGGATTC CTAAATGGAC CACCCACTTC GCATATTTCA CGGCGCCATC AATGACAGGA CGGGAATAGG TCCAGACCAC CGCCCACAAA TCAACAGCCG GTCAAATACA GGCCAGGTCA GCTTCGGACA GTAATGAACT TATGCAAATG AGTGAGTTAT ACCGCGCACA GAATATTGCA TTTGAATCAA TATCCTGAAG ACTGAAGGCA TTTGCATACA TGAGACTTGA AATCAGCAGG CCAGGTGAAA ATGAAAAGTG TGGGGCAAAC TGACGAATGC AATTGCAAAT TTCGGGAAAC TAGAGCCAAA TCATATCGTG ATGAATTTGA AATACATAAG CCGACACTTG CTTTTATTTA ACCTTTAAAG GGCTTGTATC GTAAAACAAC ATTTTTTATT GCCATCCATC AAAATGTATT TAAACATTAA AAATACATAC ATACAATGGC AACATTCTTT CGCCCTTTAA AAGTGAAAAT CAAACACATG TTGGCCGATT TTTACCACAC AACTTCGGGC TTATAATGCA AGTTTAATCA TATAACAGTG TGTGGCTGTA TTTTTATATA ATTTAGTTTG CATGGAAATC TGCGCAACAT CCGCTGGCAG GCAGATGGGA AAGGCAAATA TTACCGACAG AACCACGGGA ACTCTCCTCC ACAACAGCTG TTGACGAATG TCCTGGCCCA AGGGTATAGG GTTACGGGAC TCCCGCCACC GATCCTGCCG CCAAATCTCT GGCTCTCCGG TTCTACTCTC CGCGCATTGA GCACCGGCAA AGATAAAGTA CATTTCTGTG ATAAATATAA CAACAAGTAC CCGAGGCACG CACAAGGGCC CATCAGGGCT CGGGTGAAAA CGCATCGAAA TTTTGAAGCC CAATCTGGGT TTCATGGGCG GGGGCAATGA GAGGGTGATG CACTGGAAAA AATCCCATGT TCTATATAAA AAAAAAAGCA ATCAACACAC TTAATAATAG ATTTATATGC TATGCTCAAG TCAAGATTAT AAAAATATTT TATTTTTAAA ACAGAATCAA AATCGATGAC TTCCGATGCA AAAGCCATAG AATTAGAATT AGAAATAGGA TACTATTTAA TTTTTCTTGG CCAAATTAAC TTACTGTGCA CTTTTTGGCA GCAGTTATAA TGATGCCAGC GATACATCAT CGCAAAATGC TAACATTTTC GGCAGCCCCG GCAGTCAACA GCTGTTGCCG CTGATGAATC CTTTGGGTCC GGCCAGCCAA GGGTATCGCA TCCTTTGCCT TGCCGCTGTC GGTGCGAGTG AGTCCCTCCC TCGCCCACTG ATATTTCAAT ATTTTGCGCA TAAAAAGGAG CAAGTTATTT TTCATACTCC GCCACACCTC TTATCGTTGT CTCCTTTTTT CCGTTTTTGC TAATTTTCCT AACATAGCCA AATAAATCGT AGAAATATTC AAATGTTTGC ACCATGGACA AAGATATCGC TGAAGTTTGG GAGCAACAAC AACGTAATTA ACAGCCATAG AATATTCAAG ACACGCACAA AATATTCCAG TTTCCTATTT TCCACAATCC CATTTGGCAG TGAAAGAGTT TGCCGTTTGT GCTTGGCAAA AAACACACAC TCATATGAAT CGTTTTAATT TGTTGTGCGT GCTTTGTTTA TGCGAAAGCT GCATTTGCGA CCAGTTCGTT TTGAAAATTG GGAAGCTAAA AATGCTGCAT GGAAGTTGAA TTGGGAAGGC CAGT