Vienna Tile Information
VT ID VT040022
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204242
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 240022
Nearest Genes
Gene Nr FlyBase ID Distance
CG5308 FBgn0037908 10697 bp
CG17230 FBgn0046225 49273 bp
Sequence Length 2232
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer CCATCTTCACCATCTCAACCTGCCC
Right Primer ACACCTCTTTGATTGCCATTGCCGT
Template genomic
Sequence CCATCTTCAC CATCTCAACC TGCCCAACTG CCCAGGTAAA CTGTCAACTT AAGCCCGGTG AGAGGCCATA AATTGCCTCC GGAGGTGGAG TTGGAACTAG TGAAACCGAC AAGACGCTGA CATTAACTAG GCCAGATATT GAGACAGCTC CGAAACGGAT ATGAGGCGCC CAAACCACGA GGCCATTCCT CACGCAATCG GACAACCACC TGCAAAGTGA ACCCAGATCC CTGCACCAAG CTTCCAGCTA CCAGAGCGGG TCAAGTTCCA TTGCTGGCTT TGATTAAGTG CGGCGATACC AAGGAGAAAT CGTTATCCCG GTAAAAGGCC GGCTATGATG CGGCGCACTC GGGGGCACTG GGCCGGAGTT ATTGTTGGGC AAATTGATGC TTTCACGTGC AGATGGATGG CCGTAGCCGA GGCCTTTATG TATACTTATA GGGCTATATA GCTGGCACTC TCCATTGTTC GCGTCGAGTA TTCAAATGAC ATATTATATA ACATTGTGAA AACATTTACG CTCGCTTGTA AATATTTCAA TTTATTTAAT GCCACCCAGA ACCACCGAGT GGGTATCTTT TATGTGCATC TAGTCTAGCT GGCCTGCACA CCGCATGGAA TAAAGAAGGC ATAAAGAATG GCCCGCCATA ATCATATGCC AATAAAAAGT CGGTTAACAG GGACTCAGTT TCGGTCTTAG CACGGTTTTT AGGGTTTCTG GTCCAGGTTG GGGATTGGGC ATGGGGATTG CTACTGCGAC TGGGAATGGG ACACGTTATC ATTATGCGCT ACATCGCTTA CACATGCGGC CATGCCAGAG TAAATGGATG GGCCAAGGCG GCGATGTGAG GGTTTGGGGC TTTATAATAC ATTCAATTCA TGGCCAGAAC AAATGATGTG GAAATGTAAA ATAGATGCCC GTCCACGCAA GATGCCGCAC AAACACACTC ACGGCCAGAC AAACTGGCGC AGCATGTGGC CAGCACTACA CAGGAGAAAA AAACCAATAA AGTTTTTAGT ACGAAATAAA TATGCTTATT TCGAAATGCA ACGTTTTGCA GCAGAGCTTG GCTATTACCA AAATATTTAC GAATGGCTAA TTGGAGATAA AATCGGATTG ATATTTCTAG GAAACCTACC AGTTAAGGAT AGTAAAATAT AGTAAACAGC TGAAACACAA TCAGTAGTAA AAATGCCCTT GAATAAAACA AATAAATTAG TTACACAGAA TTGAATATTT TCTTTAATTT TCTTTTATGA TTTTCTAGTG TCTACCAGAC CAGTGGATAT CAAAACTTTC TTGTCCTTAC TTCTTTAGCA TATACGAGCT GTAAACGCTT TGTTGGCCCC AAATCTTTAT TGCAATCATT CCTTTTTTTG TCTGTAGCAT TAAGCAGGAG CGATAGCCAT ACAACATAAT GGTGGGATAA TCGCCGCCGA CACATTCACA CTTGAAATGT CAGTGGATTG CCAATTGCCC AAACCCTGTC ACGTTCCGAA TGCCCGGAGT GTTGTCAACG TTGATGGCCA GCTGGATAGA ATAGGATAGG ATCGGATCGG ATCGATTTGG AGCGGCAGTC GAGTGGAGTG GCAGGACTTC ATTAGCTGCA ACGGCAGCGT TTAATTTTTA TGCTCATGTG CCTAAATGCA ATCCAAAGCC GGGAGATCCA AGTTTGCCAG TACTCGCTTT TATGGCTTCG AAGCCCAAAC GAGCTCTAAT TGAACTGCGG GGGACAGTAT CGAACGGGGG CCGGTTTGGT TGTGACTTTG AAAGCCAGTA GCTGTTGGCT GTGTAATTGG CTAACTGTTA TTGTTAAATG GAAAATGCCG GGGAGCAGAC GGCAGACCGA ATTGTGTTGG AAAATCGAGC AAGGATGAAC CAATTCCATG AAAAGAAAAA AATGACAGGC GCAAGGTGAC TGGAAGAACC GAGCATCGGG TAATCAAAAT TAAGTCAAAA TAACCGAACA TGACAGGCAG GAAAGATGTT TACCCGGCCG AACCGAGCAG CAGTTGCCTT TTGGCAGCAT CACTCATACG CCGTGTGGCC CAGGAACTTA CACGCATGTG TACACGTGTG TGGGCGTAGC AACTGTCATT AACTGCCTCC TGCTAATGAA ACGAAATCTC CTTCACGACA TAATCTCATT ATACTTATAT ATATGTCCTC GCATATAAAT AAATTTCCGC CCGATATGAT GATGGCCACG GCAATGGCAA TCAAAGAGGT GT