Vienna Tile Information
VT ID VT041037
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204209
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 241037
Nearest Genes
Gene Nr FlyBase ID Distance
CG14372 FBgn0038156 5181 bp
CG9764 FBgn0004049 13608 bp
Sequence Length 2147
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGGGCTAGCAAGACTGACAATCGAAA
Right Primer TGGCTACTCACACAGATACACCGCA
Template genomic
Sequence TGGGCTAGCA AGACTGACAA TCGAAATATA CTTTTCTTCC AGTGCTTCAT TTTTCTAATT AGTTATTTTT GACTATTTTT CCCCAGTGTA TTGGAAGAGG ACTTATGGGA GTGGGCGGTG GTGGGAGTCT GGTGTGCTGG CGACTGGGGC TGAGTGCACT GCCATCTCAC TTGAGAATTC TCACACCTCG TGGCTGTCAG TCCAGGTTTT TCGGGATATT TGGGAGTCGG TTTATCTTGG GGGATGCGGC GCGGCGCATT CACGTGCCAG GCTTTTGATC TGTTTAGCAT TCCGTGGCAC ATCGGAAAGT CGTAACTATT GACAAGATCT GGAGCACCAC CAAACGGTCA GGTCATTGGA GAGAAATGTC TGGGAGTCGA ATGCATTTCA TGCGGCACTC GTGTATTTGT TTGCATTAAT TTGTATATGT TACTTTAACG ATTTAATGCC CAGCACGGCA CCGACCCGAC GCAGATTCCA TAGAAACGGG AGGGGAATCG ATTCGAGTCC AGGCCAGGCA CGGGCACCCA ATGGAGTTCG ATCCCCCATT CACCATTCAC CATTCCCCAA TCCCAGGTGA CTGCACTCGG CGGGGATTTT TCTCTGGCTT TTTGGTTTGG TTTTGGCCGG GCGCAAATTG CTCGGGCGCT TCTTTACTAC TTCCTTTCCA TATCAAATTG TGTGGATATT GCGCATCAAT CACTTGATAA AGAACAACAA TGCAGCAGCA CTCGCATGAT GAATAACATC TGCTCTGGTC GAATCTGAAT TAAGGCGCAA TGTTGTGCCG CAAAAGTGAA TAATTCAGGC GAGCAAATAT TGTTCGATTT AATTAATTTC CAATTGGCTG TCTAGGGGAT TATTATTCAT CGCGAAGGCT CATTTCCGAC AGGCCTCATT TTCCAGTGCT TGAAAAATAT TTTACTTGGC TTTAATTTGC TGTGTACTAA GGTGTAATTT TTCTTAATAT GTAGCGGATG CATGCAGGAA GTACAAATTT AAACAAAAAT AATCCATTTA CCGCTGTTTG CATTCAAACA ATAAAACAAA ATCCGAATTG GAATTTTCTT TTCTTAACAT TTTCGAAGAA AATCTTTTAA AAGATGCTCG TTTAAATAAA GTATTTAGGT TAAAAACACT ATTAGGAAAA ATCGAAGAAT GATTATAATA CAATTTGTTT AAGTTTCCTT TGTAAGTGTA TTTTAAAATG TTGCTATAAA CCAAATTGTA GTAAGCTAAT GTACTACATA CAAAAAATTA GATGTCCAAT TTTATAGACA ATAAATAAAC AAAGGTTTCT TAATATCTTC ATAAGTTTTG CCATCGCTGA ATAGCAATTT AAAATGCTTT TCTATCATCT AGGCAACAAC TTTCAAGTCA AGCAGGCCTA ATACTTGGGC CTAACTTAAT GTGGAAATCC CCCAACAACA TCCGCGAATA TTTGCCAAAA CGATTATTCA TCTGTTAAGC AGGGAGTATC TGCTGCCGAT ATGGAACATG GTGTAATCGT GTCTAGCTCT AATTACTTTT ACAGCGACAA CTTTTATCGC CCATCGCAGC GAATATCTCC GGATTGAGGG GCAATCTTTA CGCATAAATA AGCAGAAAGT GGGTGGTGGG TTCTTTTGTT GGCGACCCGT AAGAAGAGGA AATTTGTCAA TACCACTTTT AGTAGTGGCT TTTAAAGCAG GAGGGCTAAA GGCATACGCA TACGATATAG GTCGCTGTTA AGATCCGAAT ATCGTATGCC AAGTTTCGTG TGGCTCGCTC TTTCGGGCAT TTCTCTTCGG CTGGCTATTC GAATTTCGAG TTTCGAACTC AAATCAAAGC AGACGTCGCG AGGAAAACGC ATCGACGAGT GGAACTCCGA CGATGGGTAT CCAGTAGATA CGCGAAGCTA TAACGGTACA CATGTTGCTG TCGGAAAACG CGAGCGGTCC AAGTGGAAAT GTAGCCCAAT CCGTTCGCAC CAGGGTTTCC ATTTAAAGCG CTCCCTCGCA CAAATACACA CACACACACC GAAACACGGA CACACTCGTA CACTCACACA CTCGCAACGT AACGCACACC AACGCGTATT CGCACCCACA CACAAGTGAA GTCGGCTCTG CAAACGCACA AGTGCGGTGT ATCTGTGTGA GTAGCCA