Vienna Tile Information
VT ID VT059793
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204108
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 259793
Nearest Genes
Gene Nr FlyBase ID Distance
CG32683 FBgn0052683 1736 bp
Sequence Length 2082
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AACTTTTGATTAGGCCACGAGGTGTACTTT
Right Primer CTTTTTGCTGCTTTTCCATTGCGG
Template genomic
Sequence AACTTTTGAT TAGGCCACGA GGTGTACTTT AGAAATAAAT TTTCTTTTAA TCCGATCATA AATTACATTG CGATATGGAG TGCACAATCA GCGGGCAATA GAGCCAATAG AGATAAGATC TCCTAATTTC ATTCATGAAC TATAATTTAC ATATAAGCGC AAAAATCGAA TATTATATTA ATATTTCGAA GACGTGGCAC ACTAAATATT ACATTCCAAT AAACAACTTT TTAATTATGA AAGAAGTTTC TTCGGGCAAG TTGACATCCA GAAAAAAAAA ATGACAAAAA AGGGTGCGCT TGTCATCCAA AAAGTTCCCA AAGGACTCGC TTTAAGGTCT ATTTTCGGGG AGTGGCTGGT ATCTATTTAT AAAGCTTCCC CAATTGGAAT CCCCCACCAA ACTGCAAAAT GTGTTAATTC GTTGTACATA GCAGTCAACA AAGGTTTTTA CCCAGAAAAT TAGGGTATGA GATTAGGTTA AGGATTGCGA TCTAAAGAGT GGGTCAACTT GGGCTAATTG ACACCGAAGT CATTTGGAGT GGTGTAATTA TATTATGACT CTGTGTTTTT AAAACACTTG GAGTTAATTG TATATTAAGC GTTTGTTTCA AGCTGGAGAT TTCAAAGATT TTACAAGGAT TATATACATA ATATGTATAA TAAATACTAT ATTATAGGGT TATACTTAAT AGGTATTTGT TAAACATACA TTAGAAGACC TATAACTTTA CATATTTATA ATGTCTTACT TGTTGTATTG GATGAACTAA TTTCCGTATA ATATATATAT ATATATATAC ATATCGGTTA ATATAATTAA ATTATGTATG TATGTATGGG CATGCTATTC GATATATTGT AATGGTGTTG ATTTAATTTG GGACAGTTGG CTTCACTTTT CGGGCCAGAC TAGGCCCAAC TTTTGGCCCG ACTTGCCTCC ACAACATCGC ATGCCCAATT AGCTAATGGA TATTGACAAG GTCGCTCGGA GCGCGAGGAT GGGCTGGATG TCGATGGAGT GTTCGGAACG GGAATGGCTA TCGGAATGGG AATCTGTATC GGAATTCGCT TCACTCACCT GTCGCCGTGC GAGTCCCTGT CCCTGTCGCG TTCCAGCCCC GGATTTGGAT TGGCCGGAGC GGGTGCATCC GATTCGCCAG CAGCTGCAGC GCCAATTGCT GATCCCGATG CCTCCTCCAC CTCGACATCC ATCTCCACTT CCGGTTCCGC TTCCGGATCC GGTCCAGATC CGCAACAGGC ATGTCTGCTG CCAGGAGCCT CATGCTCCCG CTCCTGCTCC TGCTGCTGCT CCTCCTCGGG GATTGGCTCC TTTTCCTGCT GCTTGTCCGA CATCCTGGCT CTTTCCGTTT CGGGTTTTTT TCTTTTTTCT AGGTCCTGCT AATATGGACG GGTCCTTTCC AGGTCGCGAT GAAATGGTAC AGAGCAGATG CCCAAGTGTT GTAATTGTTT TTTAATAAAA TCGCTGCTGC CGCTGCGGCT GCCCAGGCAT GAAGTAAAAA AATAAAATGG AAAAGAAGAA ATGAAACGAA ACAAAACAAT GCCATGCGAA CAAAGGAAAA TTAATGTAAA TTAATTGCTG TGGCTGGTGG AAAGCCTCTT ACACCCAGCC CTCACTTTTC TTACTTTCTT CCTCATTTCC TGGTGTTTTT TTTTCATTTA CATTTTCTTT TTGTCTGTTG TTGGTTTGAT GGTCGGACCA AATTAGCCGC AATGTTAAAA TAAAAAGCAA AAAGTTCTCC TTACTGGATT TTAAATTGTG GCGAAGGTAG GAGAGAAACT ATAATATTAT TTCAACGCTT CGGGCGAGTA AATTAGAAAC TGCGTTGGAC TGAAGAAGAC CCATTAAAAT AACGTTCATA TTTATATAAA ATTAACTCCC TTACCAATAA TGAGTGGCAA AGCGCAAATA GAGCAAGTTG AGTTAATTTT TGGATGATTT ATTTTAGCTG GGAAGCTACT TAAATGCTTT AAAAATCTAT ATTTATTATC CCACTAATCT GTTAATTTGC AGAGCAGAAA TATCTCCCTG TTTTTGAGCC GCAATGGAAA AGCAGCAAAA AG