Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT057251
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204066
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 257251
Nearest Genes
Gene Nr FlyBase ID Distance
CG10706 FBgn0029761 43046 bp
Sequence Length 2179
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ATTTAATCTGCCGCGTAATGCTGCT
Right Primer TCTGTTTTCATGGCTTTGTTTTGGG
Template genomic
Sequence ATTTAATCTG CCGCGTAATG CTGCTGCATT CAAAGCTATT CACAGATGCA TCATCACGGA GCATTGGCGC TCTCAATAGG ATTAATTTTA ACACAAGGTG AGTTCAATTC AATTCAAAAA TGTGAAACAT TCGTTTCTTC TGAAACGGTC ACGGTCACAC TGTGTTTCAA ATATAGCTTC GGTCACCCTG TGCGCATCTT GCGATAATGT AATGTAATGT AATGTAATTT AAATCCCCTC ATTTACTTCT CCATTACAGA TTCGTTTTAA AAACTCTAAT GACAATATGT CCGGGAACGG TTCTATTGGT CTTCATGGTC TCGCTGTGGA TCATCGCATC GTGGACGCTG CGTCAGTGCG AAAGGTAATG GCTTTATTCT ATTATTGAAT TTATGATATG ATATTTCTTC TTGTAGAGAT TTTGATTTTC CTTTTTATTT ACCATTTTTA TTTTTGATTG TACTTATGTT TTTGTTTCGT TTTGGTCTCA ATGGTTAATT GGTTTGGTTT GTTTTCGATT TTATCGTTTT TTTTTTTCCT AATCCGTACT CCGTTTTGCG TTATCCGTAC TTTTCATAAG TTTTTCTCTG AACGCCATTT CCGTTAACCG TTCTGATTCA ATGTGTTTGC CACTAATACT TTGACATAAC TATGTATTTA ATATCAATGT ATGTATGTAC ATAATATATG TGCCAAGCAT TACGTAATGT CTATTTCAAG AAACCCAAAA GCTCGAAAAC TAAAGCATCT TCGTCACAAG TTGTATTTGT AATTTTTTTT ATACTCCCGT ATTAAACAAG TTGTCGAACA CATTTTAAAG TCCGGAAAAA AGGGAAAATG GGGATTTAAG CACAGCCACG GCTTACAACT TACACGATAA ACAAAAAAAA AAAAAAAATA AAGCGAATGT GCATTGTTGC TTATTCATAC GTGCTAAAGA ATTTACATGT AGCTTGCATT TTATCCGCAT ACACATATAA AAAAAAAAAA CAAATCCCCG ACGAAAGACC AAAACAGAAA CGAGTTCGAA TGCGAATCTG TAACAATCGA AATGCAATTG TCACTGTCAC GTAGCGAACG ATTGGATAAT GGATAATGCT TGCATGTGTT TCAATTTATT TACATTTGGC ATTCGGATTC GCTTGTTTTT TTTTTACCAC CTTCCCCTAT CCACCCAGAA AGAACCCTGA TTGCTGATTG CTTTTTTACA TTTATCTTGC CTGTACTTTT CCCCTTTTCT GACAACTGAC AACTTATCGA TATATTCGAT GAAAGTTGAT TGTCGTCCTG CACTTATCGA GGGGAAGGGG ACAACAACAA CAAAGCAAAA AGCGCACACA CTAGTACAGT TGAACTCAAA AATATAAAAT ACATCACTTA GAATTGGAGA GGCAGTACGA AGAATTGAAC GTGACTTTAT AGAGAAGTAA GATGATGCAT GCAATTGTTA TCGATATCGA CATTTCAACT TTAAATGCAA CCACACTGTA ATGCCTCTAA TGCAAATTAA ACAAAAACTT TCGCTCAGAG CTCATCTTAC TTCTCTGTAT CGCGCTTAGA ACTTACATAT ATCCCATTCA TATTAATCCC TATGCCTGTA AAGTCCCATT TAAAATTTTG TGTACTTTAT TAAACTTTAA ATCTTTATGT TTCAACATTG TATGCTAGCT CTTTCTCTCT CGCTCTACTC TACTTCAACT TGCTCTTCAG TAAATTCTTC TTGACTTTCC AAGGGAAATC CTGTTTGATG ACACCCTTTG TAATTGAATT GGCGCACCAT ACGTTGATCT CGCTCTCTCT TTCGACTTAA CCCTTTGGAC TCCCTGCTTC TGTCCTCTTT CAAGTTCTCT CTTCTCTCTT TCACTCTCAC ATTGATCTAC ATATTTCAGT TGTTCTTCCA ATTTTTATAT TTTTAATTAA ATTTGTTTGT GGATTTACCA CGTTCCTTAT GTTTTTCTTG TTGTTGTTGC TGTTTAGTTT TGGGAAACGA AACAAAACAA GAAAAATTAC AAAAAAACGT TGTTACATTG CATATTTATT TAATCAATTA AGCTTTAAAC TCAAATTGTC GATTGTACTG CGCCTGCATT GCTGTAGATC ATATCTAAAC ATCCATATAT ATGTAAACAA ATATAATATT GAAACAAGTG TTAACCCAAA ACAAAGCCAT GAAAACAGA