Vienna Tile Information
VT ID VT037863
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204025
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 237863
Nearest Genes
Gene Nr FlyBase ID Distance
CG1149 FBgn0015770 15937 bp
CG10101 FBgn0037501 19457 bp
Sequence Length 2086
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGTGGGCAGATTAAGCAGTTTTAGTGG
Right Primer TCGGAGTACCTATTTTCTTCATGCATAGTGTT
Template genomic
Sequence CGTGGGCAGA TTAAGCAGTT TTAGTGGAAG ACTTGCAGAT TTAATGTGGA GGTAAGTGCC AGACTTAAAA CGAAATAAAT AATTAACTTT TAATACGCTA CGTTCTACTT GTCGTAAAGG CACGTAAATT AGTTTATACT CATCATATAA CTATACAAAC GTAGTTACAG CATTAAGGTT CATAATTTTA ACCGCTAAAA ACGGTAATTA ATTGAATTGG CCGAGTCCTT CAACCAGCCA AATATTTTGG AACGTAGCAC CCAATTTCGA TGGTCAGTTG TAATTGTTTT GGATCTCCTT TCCCGGCAAC TTCCCAGTCC GGCGGCACTT TGCGCCCCCA TTGACAGTTG CCTATGGAAA TGACAACGCC GAAACAAACT TGCAACAAGA GGAGCAGTCG GTAACACAAT TGGCCAACAG GTAACAGAAA ACAACAACTG CTGGCGGAGC AGGAAGGTCG AGGAGTTACC GCAGCGGCGG TTGGTTTCCG TTTCACTAAC TTTCGCATTG CGCTTTTTGT AGTTTGGCTC CCTTGGCCAA TTGCTATTGT TGTTGTAATC CTATTAAAAG GCCAGCAATC TAGCTTTTGT TGGCACCGCC GGCTGCTGAT TTTCCAGCCT GTCAGCCGGC ATTGTTTGCT GTTTCATTTC GATTCGATTC GGCGAAACAA AGACTTAAAG TGCTCATTCA CCTGATTTTG CTGGTTTTAG TGCCGACGCT AGGCCCTTTA TGTTCAAGTC GCATGTTTAT TTAAACCTGG CCCAAACGGC CCGCTTTGTT TTTGGCCCGC CACTGGAATT GTTCGGCCTA AACGGGCCTG AGCTTCGCAG CCCTTTGATT CGGTATGAAA ATGTGCATGG CATACTTTTA TTCGGAGAAC GAAACCTTAA AAAAGATAAC TGATTGATGA GGAGCTAAAA TTTAAAGTAT CTGCTGACTT GGCCATGTGC GAGACTAGGA AATAATAAAA AGCTACTTGT GCGAATACGG AGATAAATAA TCTGAATGAG TTATGGAAAA AACAATAAGT TCATACAACA TTCTAGGAAT AAGTGGAGCT AAAAAAGTAC TATACCTAAA CTAGCTAACA TATATTTACC TGGTAAGTTC ATGTTATAAT AAATCTGTCT TAGGCAAAGC GAATTTTATT TCAAATCCAA TTAGCGAGAT ATGACTTGCA GTCAATGCTG ATTGTGGAAT GGAATGAAAA GTCCTTGAAC GAATCTGCCT AGCTACCAGA CATCCTGAGG AGTATTATCC TTTGTAATAA AAGTAACACT CCTTCAATAC CATTCACCTT GCTGGCTACA CATAAAAATT TCCAGTATTT TATGTGGAAG GCTATAAATT CGAGCATAGC TCACACAACG TTACTTCCGC TATTTATTGC CGTTTGCAGC AACAGTTCCC ATATGCTGGC CTGCGATTAC CCGATATCGT AGGGAGTTGC CTCCCATATC CCTCACCAAA TCCGCCTTAT TTATTGAAAT TTTCGCTGCT TTATGTCGCT CAGCTTTTGG CAAAGATTTA AGCCACTTCG ATTGTGTCCT TGAGAGCCTC TTACATTGGC TTCATCGGAC GGACCAGGGC AAGGACGAGT CCTTGACCCC GGAGGTGGGT GGAATTCCCC ATTTGGATGC AGTCACATCC AGACACATTG TCGTAAAAAT CAGCCGTAAT CGTCAAGATC AACCCAGTCG ATTGGGCATG GATGCCCAGG CAGCCAGATT GTGAGTACTC CCGCCGAAAA ATTGCACTCA CTTGGCCTAA TAGAGAAATC GCAGTAAATT CTGTTAGCAT TCTATGTCCA AATGGCACCA CGTCTGTATT AGCCTGATAA ATTTTGCTGT GACTAAGGAA AATCTGTTTT CGCCCAAAAC ACATACTTCT AAATTTGGCT TAAACTCTTT AAACCATTAA TAGTCCGAGC GGCTTTCTCA TTTGCCATCG GCTACAAAGG GAAGCCCACC CTCAACTAAT GGGTTGTTGT TATCTATTGC CGAATTTCTA GCACGTCCTC AGGTGAAGTG CGATGTTTTA CCCAGTTTGC AGGGAACACT ATGCATGAAG AAAATAGGTA CTCCGA