Vienna Tile Information
VT ID VT019896
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 204013
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 219896
Nearest Genes
Gene Nr FlyBase ID Distance
CG13439 FBgn0040726 1819 bp
CG13438 FBgn0034545 1956 bp
Sequence Length 2208
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCTTTCCTGTTTGAAAGGACGACTGTATG
Right Primer TTAACCGAACGGTAGCGGCGAAAA
Template genomic
Sequence CCTTTCCTGT TTGAAAGGAC GACTGTATGT TTGTATATTC ATGAACGAAT TATTAAAGCG AAATATTAAA GTGTGGCAAG TGCCTGGCAG CAAACTATTT CTCGAAGAAA ATCAAACTCA AATTACCATA TCTCTGGCCC TTTAAACGAC CATTCGGACA ATCTCTGTGC GTACATATGC TATGGACAGT AGAACATCTA TATGGTGAAC TCAAATCTGA AGGAATAACT GTCTAGTTAA GAAAAGCTAT GTAAATACGC AAGTTTTCCA TGTACATTTT GGTAATGTAA AAATAAGTTC TAAACCTTAC TTTGAAATGA AAATAAGAAT CCTTTCCTGT TTGAAAGGAC GACTGTATGT TTGTATATTC ATGAACGAAT CAGCAGCAAA CTACAATTAT TGTGCACTTT AGTATCGCAG TGAAAGGCTG AGCCTAATGA CCGAGGCCGT GACCCCAGAA GGGCAGTTGC TCCCCTCGAA TCCCCCGGCT GAAAATGCGT ACTAAATGCG CTAAATTACT AACTAAATGC CGCAAGTGCC GCCCCTGGGC ATGGCTAGAA TTTCACAAAT GAACGCCCTT TTTGGGTGGG CAGGGGGTTG GGTTAAATGG CCAGAGGGGT GCTTTTCCAC TGTTTTCTTT TTTCTTTTTG GGTTGCTTAT ACCAAAGCCG AAAAACTAAA GTCAAAAGGA ATGGGAAAGC GAAAGCCAAA CACTGCCGAC AGTCGATGAC ATTTGAGCGA TAAGAGAAAC TGTTGTGTGG CTTACTTGCT GGCAACCCTA GTGATTTTCT ATACCATGTA ATGGTTAGTT GGTTGTTGGG GGGGTCAGAG GTCGAGAGCG TTCCTTGTGG TTGTTGCTGG CATTAAGTAT GCAGGCGTGT GAATCGTGAA GGCGGATATA CAAATACGAA TAGTATATGT TAGCCGACCT TCGAAGGCAG CCACAGTGCT ACACTTGCTT TTTACAACAT TGAGAATTGT TTTAAATGTT AATGCCGATG CTCTTGGGCT GATAATAAAA TGGGGCAAGT GTGGGGAGCG GTGTGTCAGA GTCAACAAAT AATTGAGATG TTTTCCTGAG TGTCATCACA CACGCTTTTT TTTCTACAGC CCCAAAAAGT GGGTGGCTGG CAACCAGAGT GGGTGGCTGG TGCTCCCCCG GCGGACGAGA GTCAGCTGTT CTGAGTGCGC GCACTTGTGT TAAATTATGC GGGTTTGATT TTTATTGCAC TGCCGCTCAT TTCATTCTGC TCCCTTTGCT TTTTTTTCTC TCTCTCCCAT TTGTTTTGCT TGCTTTGCTT TGGTTTCCTT TGTTTTATAG GTTTTCCCCA ATGGGGGGGA GTGGACCGCA TGATACCGAA GCATACCCAC TGCCCAAAAT CAAAACCATC TCGGAAAGTA TAAACAAGTT GGAGTGACGA GCACGCGTGT GTGTGCGGCT GTAATGTGGT CATGCCTCGT TGCCCCAACG AGCTGTTGCT TGGCATTTCA ATTAATGGCA CTTGCCACCC TTGTATCTAC CATACCATAC CAACCCACTC CTGCCCTCCA AGGGGTCAGC TCTTCCAACG CTGCACTCCT AATGAAGCCG TCTCCAGCTC CAGCTCCTCC AGTTTCAGTT TCAGGAGGAA ACCAGCCGCA ACCTCATATC TGCCACCAAA ATGAAGGTCT CGTCTCTTTG GGATGCTTTG TCAATGGGCG TCGAGATATG CCTAAACACT TGAAAAAAAA AACGATGCAG TATTGAAAAG GATCATAGAT TACAATTATA GTTACTTCTG GTGCTATTAC TCAGTGATGA TTTATTCTGC CATGAATAAT AAATCTGTAA GATTTATTTT TAGCCAATGG ACCACTAATT TTTTTTGTGT GCACAATTGC AACTTCGCGG TGACACGTGA CCGCAAGGAC ATTTGTTGAG CCTGAATGTG CCGCATCGCA CGTCTTAATA GATTTTTGAT TTGTTTGCCC ACCCTTCTTA GCTGGTAACT CAGACTTCCC CATTCCGAAC CCGGATCCAT ATCCGAATTC GAATCCAAAT CCAATTGTGA GGCGGGCGTG CGTCTCTGAT TGGAATAATG ATTTCGCTGA AGCAAAGATA GAACATAAAC CGAGCCAGAT TTGTTGTTTT TTTTTTTTTT GTGGGGAGTA ACTTGTTTTT GTCAATATAG AAAATCAATA ACTGTTTTCG CCGCTACCGT TCGGTTAA