Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000204
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203986
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200204
Nearest Genes
Gene Nr FlyBase ID Distance
CG4133 FBgn0031257 6 bp
Sequence Length 1432
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCGAAGAAATTTGTACCAGTGCGGA
Right Primer GATGGATCTAGGCGAAGGGGATTGG
Template genomic
Sequence GCGAAGAAAT TTGTACCAGT GCGGACGTGG ACAAGCTCGA TCCAGCTTTA TTATTTATTT TATCAGAAAG CAGAACCCAC AACCGAAAAA ACCAGTCATT GGCAAGGCTA AAAGATATTA TTGCCTACCA TCCTTTACTT CATACCTCGC ATTGGAAAGT GAAGTTGAGT TGGAAAAGGA GAACTAGAAA AAGGATTTCT AGACCGAAAA AACAAGACAC CAACAGCACA ACGACCATAA ATACATAGTA TGAATGTCGC CTAAATATCA TAATTTCGAG GTGAGTCGCG AGCAACTCCT CCGAGCAGTC TTTTCAGTTC CCGTCCCACG GATTTCGTGT TCCGCGAAGA CGCAACTGCC CACCCCTTTC ATTCAGTTTT TTCGCTATCG ATTTTCTGCG AGGGTCTCCC TTCAACTTTA AGTGACCCAA AAAAGAAAGG GAGGGTGGTT TTAGGTCAGC CGGCAAAGTT GCGTGCTGGG CTACGTTGTA TGTTCTGGTT TCATGCCAAA TCTAGAGACC CAATTAAAAC ACTTTCAGAT TGCACTGGTC TACTTTCTGC TGCTAATACC ATGGCCACCC ACGAATGTGA TCAGAATCCT CTGCTCGCGA GATAACAGCC GACTGGTGCG CAAAATAGTG CGCTCCAAAT GGACTCCCAT TCTGGACAAG CATCAGGTAA GTCCACTACA TCGGAGTTCC CTCGATTCAA ACCTGCCTTA CCGAGACAAA TCAACTTAAA GGTGAAGCTG CCGCTGGAGT GCCCGCTCCA TCCGTTCCGG GATGTCTTTG CCCCCCGCCA GGATGCCAAG CAGAGGGATC GACCTACTCA GTGGACGTGC AGGAAATGTG GCAAGAGCTT CTACCAGGAG AAGCATCTGG ACTTACATTT CGACACACGC CACAAGAGCA TCATCAATGA GGTAAAAAAC TATTTAGAGA GAGGTTTAGT TCTAGTGTAC TGATATCTCC AATTCCACTT GAATTCTTCA GGCGGAGGAT GCCGTTTGCC TGGCCGACTT CTGCGACATT ATGCGGTGTG AGGTATTTGA AACGGAGGAC GCATCTAGCC TGAAGTTTGG TGACCAGCAC ATTGTCACGG ACATCGAGGT CTGGGGCGAC TCCCTGGGCC AGAACTCCGC GTTGGCCAAA GCGAATGCTG CCTACTTGAG CTTAATACCT AGGTGTGTTC GTTCGGCTTT GTTGCTCTTG TATTTGCCAT CAGTCATATG ACGCCTCAAT CCTTTCTAGA ACTTCCACAT TGGGTGCCTC GCGTGCCGCC AAAGTACAAA ATCGTCAATT ACTTCAAGAC AAGCCAAGCC AGGCCAGCAA GCAGAATCAG TCACCGGCAG GTGAGCGAAC ACATCCCCAA TCCCACCACC ATCCCCGAGA TCGTGCATCC ACCACAGCCA ATCCCCTTCG CCTAGATCCA TC