Vienna Tile Information
VT ID VT020596
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203957
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 220596
Nearest Genes
Gene Nr FlyBase ID Distance
CG34370 FBgn0085399 31541 bp
Sequence Length 2164
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TATTTCTAGCGAAGGGACTTCCCCC
Right Primer CGCCCAAAGTAGAAAAAGTGGTAAAGGGA
Template genomic
Sequence TATTTCTAGC GAAGGGACTT CCCCCCCATG CAAAAGACGC AGACTTCGTT GTCCCTGACT GTGACAAAGA CCAAAAAAAT GTGAGAAGGT CCTGCCACGC CCCCTCCAGC GCCCACTTTA GCAGTCAAGG CGCGTAAAAT TTTGAGGAGA CCTTTGAGAA GAACCGAGGA GAGAACTGAG AATTCGGAAG GAGAATCGTG TCGAGAGCTG AGTTTTCGCG TCGAGTGTTT GTGTGGCTTG GCTTATAAAT TACCCCAAAG GCGAGTGCAT GTCCTTTGCC GAGGATCTTT TCGCCTATAA TGCAAAAATA TTCTTGTGCC CAACTTTTTA ATCAGAGAAG CGAACTCGTT GGGATTCTGG GAGCTGGCAA ACAAGGAGGT TACGTGACCA ACATTTTTTG TCTTCGCAGT TTTTATCAGT TCGCATTTCT CTGATTGTTT TGCTGTTATT TGCGTAACTT TTTGCCGTTC TTTAGTTAAA TTATGAATGA CAAATGCGGG AGGAATACAC AAAAGTACAT TTATTGGGTA CAGTTGAGGA CAAAGGGTGT TGAAAAAAGT CTTTCACTTC CGCCTTTGCG CGCTGTCTTT CATTGAGTGC TTAGCCTAAT TAAACGAACT TCAAGGATAT ACTGAACCAC CACCCCTCTA ATTGAATCGG GCACATAATT AATATGAGAG AAACTTTTTA CGTTTAATGC AAAAGCTGCC ACACACAAAC ATCAAAAAGA GGATATAATT AAATGAATAT CGTACAGTTT AATTTAGATT AAATCAGCGA AGCCACAAGA GCACTGGAGG ATGGAGCAAG GGGAGAGCCA AAGGATATCG CCTTTGTGTG CGAATCGATA CACGCGAACG TACGTCAGAA TTTTGACGAA ATTCAATAAG CTTAGCTGCA GGCAAACCCA CGGAACCACC CATCCGGAAC CACTGAAACC AGCAGCCCAT GTCGCCACCT CCCGCGCGGC ATGTGGTCTG GATCCAAGGA TACCAAGGAT CCCTATCCTG TCCTGTGGGT TCCTTAAGCC GAAATCAAGA AGGATTAGGC GGTCGACTGG GCGGTAACAC TTTCGTGCGG GGTGAGTTGT CGGTGTCCTG GCTGATGGAA ATCGCCGAAG GCGACAGGCG AGATGGCGTC TAACAAATCT GTTTAATTTA TCAGCGTTTC ATTATGTAAT ACACATTCTA TGGAAATGCC TCCTACAGTG ACGCCTCATT TATCCGCCCA CCCCCTGCGG GTTGCCTGTC AAAGATAAAC GCGCAAATTG TAGCTTCAAA TTCAGCTTCT GGTAATTAGC GGTGGACGGC TAAGTTTCGA AGAGATAGGA GACTGAAATT TAATACGAAA TACAGAAATC TTGTCAAGTA TTTGCTAAGG GGAATTTGCA GCATTGTATT TAAGAACCGT AATCATCTCA AATGAAGGGG AATCTAAAAG AGAATCTCGA TGTAAAAAAA ACTGAAGACC TATTTCCATG CACCGCATTC TCAAAAACCC GAAGAAAGCA ATGATGAACG ATCCTTTAAA GTTTCTGCAG TCTTTGGCTA AAAAAAAAAG GAAAACACAA ACAAGCCCAT CACTCAGCCG AGGCCTTTGG CCCCGTCAAC AGTTGCAGTT CAAAAAGAAA GCAGACTGAG AGCCATGATT TAAACACTCG CCAAGTGCCA GACGGCAAAG TCCAACTGGT GGCACACTCA CTCACTGGTT AAGCCTTAAG TCGCCTTACA GCCTCCTACC CACTTGACTT GCTCGGGTGC TCCCCGGGTC TCGGAGCCCT CGTTCTTTGG TCCTTAATCT TCGTCCTGTA AAGTTCACAC AACTATTGTC ACATGCGATA CACCCACTCA ATGGGTTACA AGACCATTGA GAAGTTGAAG TCGGGGACGG AAAAGCAACA ACGACTAGAA AACAATACGT TGTAGAAATG TTACACAGAG AAAAAGGATA ATTGCCTAAG GCCAATTATT ATTATGGCCA ATACTCGTAG AGAATTAAAA CATTTTCAAT ACGACTTCAA CTCAGAAAGT TTTAATTTAC CCAAAGTAAG GTATCCAAAT TTTCCAAACA CTCAACCATT TTGCAAGCGA CACCAGTAAC TTTTCTCTCT GTGTAGACTT CAGTTTAGCT TTTACTCCCT TTACCACTTT TTCTACTTTG GGCG