Vienna Tile Information
VT ID VT013618
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203913
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 213618
Nearest Genes
Gene Nr FlyBase ID Distance
CG12780 FBgn0033301 1966 bp
CG30361 FBgn0050361 16185 bp
Sequence Length 2190
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCAAGTGCAAAACAATGCAGAGCGA
Right Primer AAGACATTTTCCGAACCTCTGGGGG
Template genomic
Sequence GCAAGTGCAA AACAATGCAG AGCGATAATT ATGCACTTTT TTTCAGCATC AAGAGAAGGT GAGCATTTCC TGTTTTCATA TCTGATGAAT ACGTGCAACA TTTTGCAGTT TACTCTCCCA CGGCCACAAT GTGTTATTAG TTGTTGGTAC ATCGGAATTC TAAATCAAGG ATCCTATAAG CTAAAATTCT AAACAGCTTT CAACAAAATT GCTCGATTGC AAAAACAGTT CTAGCAAAAA ATTAAGGATT CCAACTTGCT AACATTGTTG AAAATTGCAA AATAGTCGAG AGTATTATTC TTTTCTTAAG AAAACAAAAT TTTATTTTAG ATACAAAGAG TCCAGTTCCT CGACTATCAG ATACCCAGTC CACAGATAGT GGGCCAAGCT TTTTAACTGG GGCTTAACAA AATTTTCGGC ACATCACTTT GTAACAGAAA GGGCATCGAT TCCTTAAGCC CAACTGAACT TCCTACCCGC AATACCATTA ATAATATACT CCCTTCCTTA CATTTTCTAA ATCAAACTAA ATCTTAAAAA TAAAAAAAGC TAAGTAAATA AAATGTAAAT ATGTAAAGCC TGAAATATGC AAATAAGATA ACATTTATGT GGAAATCAAA TGTAAATTCC AAGATTGATG TTAACCGAAA TATAAATATA TGTTTATATT GTCGTAGCTT GAGGCCCCAA GTAGCTATAG CTGCAAGTGT AAGGTAATTT CATTTGTTGA GGTAATTTAA ATTATTTCGA AGCCTGGGAA TAAATAAAAT ATTTTTGTTA TCCTAAGTGG GCTTTTTATT TACCTGAAAT GCAATCATGA CCCTTAACCT GTCAGCGTGC CACAATTTAT GCGCCCGATT TGTATGCCTG GCTTGATGTT TACCGCAGCT ACTGGACTGG TTTCCAAGTA AATGCGATTG GGAAATATTT GTCTGCTTGT CGCCATGCAA ACATAAATTA AGTTGCAGGA AATCTACGTA ATTTACGCAC AAGCATTTCG TTCCCGACTA TGTGGGCGAT TTTCCTTTGC TTCGCCCATA AGTTTATTTA TGTTTATTTT GTGGCTAATG TAATTTTTGG CAAATAATCA TCTAATTTGT TTTCTCATGC CTGCCTTACT CGTCGCGTAT GCATTTAATT TATGAGTGAG CCTGGCAGCC AAATGATTTG CATCTGAATG CGGGAACTGC TATCCAAGTC AAATACTACA CTTGGAAATA CTTTGCTCTC GTTACATATG CAGCTATTAG ATTATTTACA TGCCTTCAAG CTATGAAATA GTACTACATT ATTGAATTGA TTTGTTAAGT GAATAGATAG AACATAGAAC ACATGTGGCA ACTTTACAAA TTCCAAGATG TTGTGTTACA CAAATAAATT GACATTTTTC ATTGTGCAGA GCTGGCAGTT CTAATCGTCT TAAGCTGTTA AATGCCAAGA ACCAACAAAG AAAATGCTTT GCAGCCTTTC AAGACTTAAC CCTTTTGACA TTTGGCGCTG AGGGGCTCTA ACAGAAGCCC CAAGGCGTAC GGCACATACT CGTAGTGGTC GTAGATCTGA GACCAACTCG TGGAAACCAA AACCAACTCG GGTTGACACA TGACAAAGGT GGCCTTTGAG TCAGAGCACC CGGATCCAGC TCGCTGACCA CAAAAGAGGC GGCCCACTCA CAAATGCAAT TCCTGCCGAG ATTTATGGCA CCCGCTGGCT GTGTGCTACA AAATGGGAAA ATGGGTGAAG CAGAAGTGGA ATCAGAAGCC TTTTTCAGGC TGGAAACAAA AATGAGGAAA AGCTCATCAC GCACTTGGCT CAAACGTGCG ACTCGGCCCA GATGACATGT TGATGCCGTC TACATTCAGT TCGAGTTCAG TTAGTTCAGT ACGTGGCCCC ATCTGACGCA CTATATTCAG CCGAAATTAA GCATGACTCT ACTACCCTGC GCAGAGCAAT TGACGAGGAT TTCAGAAGGA GGAGGAGGAG CTGGAGGATT AGGCCGGGAG TAAGATGCTT AAACACTTTT TAGCATCAAC CGGCTCATAG ATCATGCAAA TCGTCACGCA AATAAAATTC TCGTAATGCT AAAAGCGACA CAAACAATTT AATAAAATCC AGCTTAAAGG AAATTTACAT GCTCCGCAGG GCACCCAGAT ATTTTACCCA CCGAACCCCC AGAGGTTCGG AAAATGTCTT