Vienna Tile Information
VT ID VT044959
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203868
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 244959
Nearest Genes
Gene Nr FlyBase ID Distance
CG5630 FBgn0038842 6407 bp
CG31191 FBgn0051191 22516 bp
Sequence Length 2309
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCACCAGCTCTTCCAGACCATAACCA
Right Primer CGATTGCACTGGCCAACAACAGAG
Template genomic
Sequence GCACCAGCTC TTCCAGACCA TAACCACCTA GTGCTTGCAG ACTGGCACTT GTTGTGCTTT TAACATGTTG ATATTGTTTT CCTGGCCACC CAAGCTCCAC CCATTCCCTT TGATCCCACC TCCTCCTCTT CCTCCTCCTG CTATTGCCCG TAATTTTCGC AATTTTCGTT TGCGGCTCGT GCCGCTGTCA CATGGCAAAT CTCGAATGTC GGGCATCTGG AATGAAGTTA AGTTACCATG AATGTGTCAG CCAGTCTGTT TTTGTTTCCC CTCGTTATTG TGCCTGTTTG TTGCCATCAG CTAGGACCAA CCAGAACATA CAGGACAAAG CCCAATGACA GTTGGTATAC ATGCTGCACT GGCCATCCTT TGTGCGCCGA CTTCCCTGAT GTACGTTGAA AGACCCGGCT ACCTTGATAA GTAAGTTCCG AGGCGTACCA ACATCAACCA GACCACTCAA ATCCCTTGAA TCGGGCCGAA GGTGAAGCCA ATTGACATTT CTCGATGCAA CTGATCACTG AAACGTGTCT ATAGTATGTA TCCTCCTTCA AATCGGCCAG ATGTTTTATA GAAAAATATT GCAATGTACT GCCTACATTT CGACCCGGAA TGAGCAACAA AAACCTGACA GAAATGGGGA AAAACATTTT CCACTTGCAT TGTTTTCCAC TGGTGGTTGA TGATGCCCCA CTTTGCTCTG TGTGTGTGTC AGTGTGTAGT GTGCGTGCCG CATAAATTTC ATTTTGAACA ATAATAAGAA AAGTTGGCTG TCGTTGGCCT GCAGGGCAGG CTTCCAGTCA GATCAAAATC ACAAACGGCA ACAATGGTGG TGTTTTTTGT GTGTGCATTA AATAACAAAA ACACCGAAAC AAAAGTTTGG TGAGGAAGAC AAAAAAAAAC AGAGAGCGAA AAAAGCGGGC GACGGCTGGC CAGGGCCATG TTACGTATAC GCACCATTGA GCGGCCAAAT CGCATTACGC ATTCGCCATG TGGTCGGTGC AACCTTAATT ACAATCCCCT TGCATTCGAA CAGCAGGAGT GACCCACATT GATCTCACAT CGACCGGAAC ATCACAATTA TGCAGTATGC TTCGAATTGG ATTGCTTTCA TGTGGATGCC ACCACCTGAC GGCATTTGCA TTCTGTTGGC GTTGCATCTA CGTGCCTCGC CGTGATGTGT GACACTTTGA CACATGAATA GTGCTAGGGA TACGCCCAGG ATAACTCTGT CTTCGCCTCT GTGGCGACGT CATGCTCTAA GCCAATTAGG TGGAACAAAG GCAACCACAT CTAACGCCAT CGCCACGTGT TGCTCTGGCA TAAACAATTT ATGAGCGAAT TCTTTCGAAG AAAATACCAT CAGGGCAAAC CGCAAACACT CGGTACGCAC AAAAAGTATT AAAAAACTTA ATAATCATTA TATTTGCAGA GGGGGATTTA CTCACAATTT TTTGCTGATC ATTAGCATCG GCGTCATGAT GAGCGTACCA AGAAAAAAGC CAAGCCGTTT ATTGCGTATT TTTAGGTCAG AGCAAACAGT GGACTCAATA TGGCACGAGG CCAGTCCCGA TTGAAGCATC TTCTTACCTC GCTGCATGTT TTCCCCACTG TGTTTGCCTT TAATCGCATC TGCAATGAGT TTTCCGACTT TGATGAGTTT GTGCTTGCTC GCCCAGGGCC AGCAACCGAA TTTCCATATC AATTAGCAGC CCTGGCTCCG ATCGAACATT TCCGGATGTT TGCGCAGCCC CACCGCTAAA GTATACCCTA TCTATATCTA TATTTGAGTA AATAAAAAAC TAATGAAATC CGATTTTCCG TGCCACTTTA TGGCTTTGCC CGCTATTCAG TTACTGGTCA GCAAAACAAA GTATCGAAAG GAGGAGGCCA CGGAACATGT TGCTTCTACG ACACTGGGCA GTAAAATTTT GGGCTTTTCC CTGTCCAAGG AAATTGATTT TTTTCATAGA GATTGCTTAT CAATAAACTA CGTTTACGAG TCCATAAAAA TTCATTTTTG TGTTTAGGAC CGAATATGTT TTAAACGTGA GCCTAATAAG AAGAACTCGG GAATAATGTA TGGAAGCATC TAAGAATGTC TATATATCAC CGTCAAGATA TATATTTTTT GTAAAAATTG TCTTTTGTAG TCAATTTACT CTGTAATTAC AATTTTTTAA AATATTAAGA TAAGAAATAT AGTTAACTTG AAATGAATGT GAAATTCTAA AACATATCTT TTGCCGCCTA AAATCTTCTA AAATATTTTC GTGGTTTTGA ACTCTCTCTG TTGTTGGCCA GTGCAATCG