Vienna Tile Information
VT ID VT021842
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203853
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 221842
Nearest Genes
Gene Nr FlyBase ID Distance
CG4356 FBgn0000037 5752 bp
Sequence Length 2298
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCCACTGGTATTCACATTCGCCGTT
Right Primer GCGGGCAAGAAAGACTCCAGCAAG
Template genomic
Sequence GCCACTGGTA TTCACATTCG CCGTTGTGCT CGCCGTAACC GCACTCATTT CCTGCAGCTG CGAGATGGAG GCAAGCGGTG GGCGTGGCAG CGGCGTGGGC GAGACATCCG ACAGGAGAAT GCTGGGCGGA CGCACGCCGC TCACGCTGCC GCCCATCGAG TAGTTGTCCC GCATCACGTT CATCGAGGTG CATCTGCGAT GTGAAGAAAG AGAGAAGACA GGATGTGGCA TCGGTTTAGC ATTTCAACAA ACACGCATTA GAGTGGACCA CTCCAACGAC ACTGACAGGC AAACTAGAAC AAGAACAACA GTTCGGGGCC AACTCTGGAT GCAACTGTGC CCCTGCTCAA CCAAATGTGG CACACTCAGA CACACAGGAC ACAGAAACAC ATCATGCATG TGGGCAGTGC ATTTGGAATG AAAACAAGTG GCCGGAAATC GCAGCATATA TCCATTACCC AGCCGATTGC CAATGGCACA CATAAATTGA AACAAGTCCA GCGGTCAAAG AGATACGTAT CTTTTGAAAA TGCAATTCTG GCATTTGTTT CATTTATAGC TATCGAGTAT AAAGTGGGCT TCCTACACAT TTTTGGGCCG CCCTGACTGG CGACACATCG CGAATTCATC CAAAAGCTCA TTTTCCCAAC TTATTTCTAT GCTTTTTCAG ATTCCACATG GATTTGCACA TTAGCAAATT ATCTAGCTGT TTATATTTGC TAATTAATCC CCACTGATCT ATGCCACCAA ATTGCACGCA ATCGTGCAAT TTCGTGAAAG TTTCATTTGC ATGCAGCAAA TTGAACTAAA CGTTTTAGCA GACAAATGAA AAATCATATA CAGACATTAA ATATTAATCA AATAATAAAC TAAATCCCAT AAGTATTTAG AAAAACTTCT ACATATTCCT AAAATATAAA TGTCATCAAC TCGTGTTTCA CTGCATATGA ACACCAGAAA TGTCTCAATG CTCGTAGAGC GATTTGTGTT CTAAGCTTAA ACTATCACTT GATCAAATCC AATTTCATGA ATTAATTACA GCCATCGGAA TCAACAAACT CCGGAGTACA ATGTCCTGCT CCAACTACAT TGGACTATAA GCCTCAATTA GTTTCCATCC CGATGTGTGC AGTGGTGCAA AGCCTTCCAT CTACGTGGAT TATTTTAGTG CTGGATGCTA TGACTTTGAT GGATTCGTGT GTGGAAGGAG GATTGGGAAT GGTCAAGGGA GAGGGAAAGG GATTGGTGCA TCGTGGTGGC CAGTGGAGAA TGGGACCAAA CTCATCCTCC TGGACACTTT TCACCACTGC CACTTTGCGT TTGTGTGCAC AGACATTGGA CGGAATATCG AATCGATATA TGTGTTTTGG GTGCAGGTTG TTTGTTTGGC TCTCGGAAAA GTGCAATGGG TGCAATGGAA GTCGTACGAG TCGTACGCAT ATAACTTGGG GTGAGAGAGT GGGTGCGGTG TCGGCTTACT CGAAATATAG ACGATTAAAG TTCAGAATTT TGATTGTTTT TACTACCTGG AGACGGAGCT TTGTAAAGGA GTTTCAATTG TTACTGGTGT TGCATACCCT AAATCAGAAG GCTCCTCCTG CTCGTAGGCG AAGTCGTCGG AGTCCTCGCG ACCGGAGTGC CACCACGCAA TGCACCACTC CTTGATGCTG CCGAAGCAGG TGTACGATTT TTTGATTGTA TTCGTGCTTT TGATCTGTGG ATAGTGGGAA TTAGTAACCA GGAACAGGGA AAAGGCGGTC AGAGTGTCCT ACGCTTGACT TGCGCGAGTG CATCCCGTGG TAGCCGGAGT CGATGACCAT GTTGGTCATG TAGACACTCT CCGCGTCCGG TGAACTCTCG GAGCGCGGAC GTCGCCAGGT GTCATGGTCG TTTCCGCCCA CCTGGGCGAA GGCCAGCAGG CCGCCAGAGG CGTGATTCAC CACCGTGTTT TCGTCACTGC AAACATCACA AAATAAGATT ATTTGTTCAA ATGCTTAGTT ATATATTTAG ACCGACCAAA GGCTTCGACT GTAATCATGC CCGTTTCAAC GTGACATAAA ATCAAACAAA ACGAATTGAT AAGCTGCGAA ATGAACTGTT TCTACATTTC AAATTTAAAA TGATGCAGCT CATTGAGTCG CCAAATAAGA ACAAGATATT TCAGCGCAAC GTTAAATAAT TTAATATTAA TTTAAGGTAT TACTGAAACT AAAGTAATTC TTCAAGAGAT CTTACTGTAT ACACTTATCT TATGCCTCAC CTGCTGTTTG ATCTCTTGCT GGAGTCTTTC TTGCCCGC