Vienna Tile Information
VT ID VT008145
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203763
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 208145
Nearest Genes
Gene Nr FlyBase ID Distance
CG7644 FBgn0028645 24145 bp
Sequence Length 2160
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCGATCTTATTTTCTGTCTTTTAATTGCGTTG
Right Primer AAAGTGTACTTGGGAAGCCGCCTTTA
Template genomic
Sequence TCGATCTTAT TTTCTGTCTT TTAATTGCGT TGATAACAAA ATTTTAAGTA CTAAGCTCAA GAAATACATT TTATAAATGA GGTTCGTGCC TTAAATAATC TTTATATTGA AGCTATTTTT AGAGATAAGC ATTTCTGGCA TCTGACCTAC TTAATATGCC CAAGGGAAGC CACACATTTT AAATCAATTA CGAATATGCT ACGTTCCATC TTTCAATCAA TCAAAGTGAA TTGGTTGCCG TGGCTTGTTT TTTCCCGCTC ACTTAATATT GAATGCCATC AATAACAATA ATTTTCATAA ATATGATAAG ACATAAATCA CAAAGTAGCA GGCGCCACAA AGTGCCTGGC CAAGGGTCTG GATTTAGGTC CCCCTCCCGA CAGGACCATC AGTCGGGGTC ACCACCCATC GTCTGCACTG TCACTTGGTC ATGCGAGGCA CGCGCTTCTC TCAGAACGAC ACAAAAAGCG GAAAAAATAA GGAGAAGAGC CAACTTTCAA AACCCGAAAC TTTCATACCC TGGCATTAAT AGAATACTAT TGACTAGTCG ACCAATAAAG TGCGATGTAT GCATAAAAGA CCTTTACTTA AAAGTTTTAA GCTTTAAGTT TTACTAAATT TTAAATCGTG TGAAAAAAGA GTGCATATTA TGTATTGTTG TTGCCTTTAA AATATTAGAT AATATTAAGT GCGTCTATCT ATCCTGGTTT CTTGGGCAAA TCTTCACATA CAGAACTTCC CGTATTTAGA ATGCTCTTGA ATACAAGATG CCTTTGCATT TAAGATAAAA AATGCATAAA CAGGTGCTAA ATAGCCATAT ATATATCAGA TTAACATTAC AATACCCTTT GCTAGGGCAT AAAAAGAGCA GCTAAGCAGG GACCGCCCAG TTAGAGGCGA TGGGTGGGGG TTGGTTAGCG GCAGGACGCG GAAGGACGCG GCAACGTCAC GCGGCGTTGT CATGGCGCAA TAAAAATAAA AATCTAATTA GTATGCCGTT GACAGTTTAA TCGTGATTAC GCTGGCAAAA ATGTCAGCTA AGCGTGGCAG AAGCGGTGGG TGGCGCTTGC CAGTGGGTGT TGGGCGGCCG TTGGATGATG GGTGGTAGTG GGAGTGGGAG TGGCAAAGCG TCAACATCAA CATGCCAACA GTTGATTCCT GGCATTGTTG TTCCTGCTCT TGGACGTTGA GCTTGGCATT TCCGGCAGAC GCCACATGCA TCGCGTGCGT GTCACAACAA CAAGTGTGTG TGGGCTGGCG GACGTGTGTA TATGTGAGTG TTATGTGCGG GTGTCAAAAG TTTAGCACTG AAAATTGCCC GCCAGTCCGT TGCTGGTTTC CCGAGTGGGC GGCAGCAAAA CGCTATATAA AAATATAAGA AATAATAAGC CATTTCTGGT GCAAAGGGAC TAGAAGTGAA CTGAAATGCG AGATGTTGTT CAATAGTTGG TGAAAACATG CCAAAATTAT AAATATCTTT AAAAAAAATT TTCTTATTAA ATAAATTCAT TGAAATGATA AAAACGTACT TATAAGAGAA ATGTTATAAA ATAAATTATT AAATAATATA ATGCCCATCA AAAGTTATGG GTTTTCAAGG ATTAACGGTG ATAAGGAATA ATATATATAT TCCAAAACAT AATATATAAA TATATATGAC CCAAGCTCTT TCCGTACAAC CAAAAAATAT AAGAATAATA TTTTCTTAAT GATCTCATTC AAGTAAAAGC TAGAAACGGG GTATCAAACG AATCTCGCTC TGACGCTTGT GGGCCTTTTA TTTTTTTGGA AATATGCTCC ACGGCCAGAC ACTCTCTTCC TGGAAGCCCC CCCCCCTTAA TGTTGGCCAT TGAAATGCGT GTCTAGTGAA GGATCCGCGA GACGTGATTG GAAGTTTTTA GCAGGTCCTG TCGCCGTTTC CTCTTTGTTT CGATGGAATA CGAGTGGTTT TGCACCAGAC GGGTGGGCGA TGGCACACGT CTCTTTGCCA AATGCCAGTT AGTACGTTCT GGAGGAGGGG GAGGCGTGTG ACTAGCCCGA ATTAAGAGCA AGCAAGAAGT GCAGATCTAG CCCAGACCGG AACCGGAAGT TGCTGTGATG AATTGCTCTG CATCGACAGC CGCTTGCGTG CCTTTAAAGG CGGCTTCCCA AGTACACTTT