Vienna Tile Information
VT ID VT021450
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203727
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 221450
Nearest Genes
Gene Nr FlyBase ID Distance
CG4019 FBgn0034885 3544 bp
CG5403 FBgn0004795 12159 bp
Sequence Length 2166
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TGTGATATATGAACCCCAGTGGTGGAA
Right Primer CGAGAACTGACTGAAGAATTGCTGCG
Template genomic
Sequence TGTGATATAT GAACCCCAGT GGTGGAAGTA GCTACTGGGG TGGGTTGTTT TTTTAGGGAT CATAAATAAT AATAATACCT CCGTTTCTAA TTATAAAATT CTTAGATTGG ATATATACCA AATATAACCA AATGGTAAGC GATTAAAAAG AAATGAGGCA TTATGTTTTT ATATAAATGA ATATGCAGTA TATTTACATA TATCTTAATT ACTTCAGCCA TAATTTGATA GCAACTGTAT GTAGTGCTTA GAACTTTTTA AATAAATTAA ACATTAGCAT TAGTATCCGC TCCATTTTCT ATTATTTTCA AGCAGCGCCG TGTGGACATT AACTTGACGT ATTCGAGAGA TCAAAAATAA CCGACTCACG GCGATTAACA GGAATTAACA TGTATCGCTA AAGTCGGCCA AATATTGACA ATCGGCCGAG GCGAGTGAGT GACGGAGATC GGATGTATCC GGTCCAGCGA TGAGAAGCAG GATTGGAAGG AGGAGGAGCA GGAGGTGCTG GTGGTGCTGG AGGCCCTGGA ACTGGTTAAT GTGAGTACGT ATACGTATAA TCGATTTCAC ACTACTTTTT AATCACTACA AAACATTTAT TGTTTGCCCG CAGCGAGAAA AGTCAAACAA AAAGCGGCGA CGAGTCGGAA TGGGTCGAAT GGCTGAACAA ATTGACTCGG CCACATAATT AGGCACTTGC CCATGTCCAC AGCTTGTACG ATATATCCAT ACACATTTGT ATTTGTACAT ATACATATGT ATATCCCTTC GATTCCGTGC AGTTGAAAGT ATCTCACGCA GTGGGACAAA AGGTTTTTAT TGTGCGTACC CGTTGACAGC CTCAATCGAC GGGGTTTGGT CGAAACTTAC CTTTTGGGTC GCATCGTTTG TTATATTTGT TATTTATTTT GCGGTTATAA TACTTATGCA CTGGCCGGGA CGGAAAAATA TTGGCATCCA TTCAGCGGGA CAAAACATCA CGGCGTTTTT ACAGTTTCTC GAGCCGCGAC CGGATGATAA ATTAGCTTTG TACGTAAATT CAAAATGGAA AATCAGTATG TGAAAATATC CCCAGCTCGA GTCGAGTCGA GTAATTGTGT AAATATCTTG TCGCTGCATG ACAATACCAG ACATCCCCAT TCCGCCTTTC TTTGCCGCAC AATGAATGCC ACATTATTAT TTTGTAGTTT GTCAACCAAG CCGAGTCGAA CCCAACCCCG AAAAAGGCGT TTTTCGAGAC GGGTGATGAG ATGGGAGATG GGAGATGGGA GATGAGAGAT GATAATTCAA TGTCGCTCGG CCAGCGCACG GATGCAGATA CAATATCTTT TTATACACAT GATGACCGCG CAGGCCAAAG GAATTGTAAT TACGTGTCCG TCGCCTTGTG CCGCATTTGT ATCTTCATTT GTATCTGTAT CTGCATTGCG AGTATCTGTA TCTCTGTATC TCCAACAAAG GCATCAGCAT AACAATGCAC CCATTTCTGT AAGCTCCGGA TCTGAACTTC TCCCCCTCCC CCCTCCACCC AGCAACGCGC TGTTTCGCTT AATAAGCGCC TAAATAGTGT CAATGATTAA TTGCTTTTGT GATTAGATGG AAATTTAATA GATTTTTTAT TGTCTGCCCG GGCAAATTGA AATTCTATCA AGGTACAAAC ACAAATGCTG GAGGCACGTC TGCTCGTTTT TGTCTCTGCA ACGGCATCGT TATTACCCTC CTCACAGCTT CAGTTCAGTT ATTTGTCAGG CGGGCAAAAG AGCCGCATCA TTGTTACCAA TTTCGAATTC AAATTGAAAT TCACACGCGT CACGCTGCCC GAACCAAAAA AATGTGCCAC AAACGCTTGA TCTGCTCCCT GTTTGTTAGC TTTCCTCAAC TTGTTAGCTT TCCGGGCAGA GAACACATAG CACATGGCAC AGACCACAGA CCCAACCCCA CGAATTCCTC TTATATTAAA TGTAATGCCA CCGCAAAAAT CCCCAAAGCC GGCCGAGCGA CCACAGGCAA ACGGAAATAG ATACGGAGAA GTCCTGCGAC TAGCAATCTG CTCAAATCCC ACACAAAGTC GCAAAGGAAA CACACACATT GAAAGGGGAA ATTCAAGTGG AAATTACTCA ATTACAAGGC GCGTCCCCTG CGCAGCAATT CTTCAGTCAG TTCTCG