Vienna Tile Information
VT ID VT063303
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203685
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 263303
Nearest Genes
Gene Nr FlyBase ID Distance
CG12432 FBgn0030843 8978 bp
CG8527 FBgn0030844 23219 bp
Sequence Length 2323
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AGTGCATTGCTGGCTTGCCACTG
Right Primer GCATTTATTTATAACGGTGTTGCGGG
Template genomic
Sequence AGTGCATTGC TGGCTTGCCA CTGGCAACTC AAAGCAGCAA CAATGAGCTC TGTGTGCAAC TCATGTTTGA TGTATCACAC ACTTGGACGT GGAATTGGAT GAGGATGGAG AACCGAAGCC AAGGATATGG ATATGGTTAT GGATGTGGAT GTGGATGTGG ATGTGGATGG ATGTGAGCAC TGGACAAAGT GTCGATGAAG TGTTTATGGC CAAACAGCAA ATATTCGCGG AGCAGGAGAA CAAGGTGCCT GCGTTCCTTT ATGAACAGCC ATTGTTTTTA GCAATGGATA CATGTACATG CCTTTCCAGC CCAGCAACAC TACGATGGCG ATGGCGATGG GGATGGGGAT ATTGATCTGG ATCTGGATAC GGATCTGGGT TGTTGCCACG GTGAAAGTGA TACACTTAAG TGCCTAATTG ATTGACCAGC GAAATTGTTG GCATTCCCGT GGAATTATAT TTATATATTT TCATATTATA TTTTCTTTGT TTTTTCTCTT TTGTTTTGTT TTGAAGATCT TTAAAATACT GATTAAACAT TTTTAGATGT TAATAATAAT GTATTTTTTA AAGAAAAGGG GAACTCTTTT TATTAGGGTA TGCACTTTGG CCATTTATGT AATGATTTAC TTTGCAGGGG AGGAAAGAAG GAAGATCCCC CGAGCAGCAA TTTCTGGGGG AAGAAGAAGG GAATCCCCAG ATGAGGCAGT GACTCGACAA TTACCGCACT CAGCATTGGG CATTCAATTT GCGCCGCGTC ATCGTTTGCA GCCATTAGAA GCCGTGGAAA ACGCAGCAGA AGTTGCAGTT GCAATTGCAA TTGCAGCTGA AGTCATCGCA GCGGCATTAA CAATTAATGT GCCACAGCTA CTGCTGCTCC ACTTGGCTTC ACTTCGCTGC ACTTCAATCT CGGACAGCTT TCGGCTAACT CTGCACACAG AGGAAAAAAA AAACGTAGGG CAAAGAAGTT TCATGAAATA TCAAAGATTA CATTTTAAAA TTCGGACTAT ATTTTTAAAA CAGCTGCAAG ACTGCTTTGT TTAAAGTTCA ATAAAATCGA TGTGATTCTA GCTGCATTTT TTTTTTTCAA GTGCATTAAC CCTCCTTCTG CCAGACGTTC ATTAAAAACG TTTAAAGCGG CGGGTAAATT ATAGTAATTG CGCATACGCC GCGTTAGATG GGCATGACAA TAGCAAATTG TTTGGCATAT GACAAAATGA CACCCGTGCA AGGAGAGCTC CTTCTTCTCC TCCTCCGTGG CCACCATTCC TTGGCAGACT TGGATTCCCC GGAAGCTGCC ATCATCTGAG AAGAGTAAGC TCCGCAGATT AGTTCTGTCT GGCGAAAGTT GAAAGTCGAG AAAAGTTGGA AGCTCAGGTA AAAATAAAAG AATTATCAAT TGACATTGCT TAAAAAATTA TAGATTTATA TGTACATATA TTAAGCCAGT TTCATTTTAT TAAATAAAAA TAGCGAGGCA CCTAAGCAGC TAATATAAAA TCAATCAACG CCACAAGCTC CATTCCGCTG AGCGGCAAAA CCAAACTTTC CCACATTACA GTTTACACAA AATCCCCATT TATTTGACTA GTAACGAACG CCCCTGCACG GCCCTTTTTT TGCGCTGTGG CCTGTGGCAC ACATAAATTA GCCGGCACTA AAGCGAGTCA ATTTCGCTGC ACATTATGGC TCAAATTATC AATGCCCATA AAGTATTTCC TCTTTGGCCC AACCGAGGGA AAAGTTAGTC CACAAAAATG TTCAAGCAAA AAAAGCTGCC TCCACACAAA ATGCGTTCAT CACGTTTCCT CTTCGCCGTT TTCCGTGGAT TTTTTTTCCG TTTAGTATGA AATAAATTTA AGGAAAGAGT TTCGTCCTCT TTGGGAAGAA TCATCGGGGC GCAGAAGACT GCAAGCTGAG ACGCCCACAA ATGCTAACAA GTGAGGGAGA TGGCAAGTGA GCGTGCGAAC GAGAGCGCGA TATAGAAAGG GACAGAGCGA GGAAGATGCT GCGAATCTTC TGGCTTCACG CTTCAAAACA TAAGCTTCCT TGGCACTTAA AAAAAAGCAT TAAACAGCCA GTAAAAAAAT TAAATAAAAT AACACAAATA TGCCTAAGTT AATATACTTA TTCTCTTTTT TTCTAACAAT TTGAAAGTAA ATATTGTTTG ATCTGAACAA ATTTCTGGAG CACTATATTT ACATTATTGA ACTTAGAACG AACGAGACAA TTTTTTTATG GGTTTTGATT TATTTAGTGT GTAGTGTGTT TTTTTTTTTG TGTATACCTG CATTTCTCCC GCAACACCGT TATAAATAAA TGC