Vienna Tile Information
VT ID VT022236
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203596
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 222236
Nearest Genes
Gene Nr FlyBase ID Distance
CG30430 FBgn0050430 410 bp
CG16778 FBgn0003715 7603 bp
Sequence Length 2099
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCAAGTCGTAATAAAGGTGTTTGACTTTCCA
Right Primer GATTTCCACAATGGCGGGCGATA
Template genomic
Sequence TCAAGTCGTA ATAAAGGTGT TTGACTTTCC AAGTCTTTTT TATTACAGGA ACTAGATTCC TGTCCATTAC CGCTCTTTTA GACCATCAAT TACGCTGGTA ATTGCCCAAT GACTGCAATA AAATCCCCCT TTAGTTCCCT TGGTGTATAT TGTTAGTGCT AATTTATGCG CAGCCCAAAG CAAAAGCAAA ATAGTTTAAT AGGCAGGACC AACACTTCAG AAGTCAGCGG GTCAGTTATA AACCAGTTGA CCGAACTGAC CGCTTCATAT TGGGCTTGTC GCGCCTGGTC ACTTCCCGTT TTACTTTTCG TCCCCTAGTT TGATTACTGT GTGGTCAGTG TGAACACGAA TTAAGGAGCG TGTTATTAGG GGTTGTGACA AAGCAAACAT GACATGAGAC TCATTATCAA TTCAAGTAGC GTTAATTGGC TTTAGATTGT GGAAAGGGGT TAAGGGCTAT TATACTTGAC CATTGGCTTT GCTAGGGGGA CACTTTAAAA ATTTAAATGT AAGTTATCTT CCTAAAAGTC GCTTGCTTGT ATTCCATACG TAAAATCCAC AACATCCATA TCCCACCGAG ACCGAGGGTC GTGTCTGGCG ACGACAGCGG ACACATTATT TTAATTTTCC ACCAAAATTA TTTTCTTATA CCCCAAAAAA AAAAAAAAAC TAACAAATGA ACGCGAAAAG AAGGGTGGTA AAATAAAAAT TGTATACCAT AAAAAGAGAT TCCTCAGAAG GGCCACATTA AATGAGTTTA AATAATTTAT GCCATTGGCA AAGTCTGAGT CAGCGTAAGA TCATGGGATG TTTAGCAGTA GGATTTATAG TGAGGTAGAA TAAAACGCGC AATATAGACG TGTGATATTA GAAAAATGGT ACCATTAATA CAAATTATGA ACGTTATGAG CTTATAATAC ATCTTTTTTT ACATATGTAA AAATGGTAAT TTAATTTCAA ATTTGAGACT TGTATAAATT TAGTTATGTT TAAGTAGTAT ATAAAGTAGT TAATTACGCT ATTAATTATC TTTCTCAATC ATAGAAGTTA TTTTGACAAA TATTTTGACG ACTGCGAGTG AATTCATTTC TTAGATTAGA AATTATTGTA TATAGTTTTC TGGCACGCAT ACGCACTTGT TCGTTTTTAC GCTTTCAACT TAAAGCTACT TTAGCTCAAC AGATCCAAAT ACAAACATTA TTTAAATGAA AGAACTGTCC CTTTTGCTGC GAAAAACTAC ATAAAGTTTG CAGAATCTTA TAGTTTTTGG TCGAGAATTA CGTATTTATA GCCATGTCCG TCGGTCCGTA AAAATATATA ATGTTGAGGT CGATTTGCCA AAAATCTTTT TGCCACGCCC ACTCTAACGC TCTAAAGCCG CCGAACTATT CACGCCCACA CTTTAAACCA TTTTTAAATT TGTTCTCTTT TTATTTCCCA ATCTCAATTG ATATCGCGGA AAAATGCTGA AATTTCGCGT TCACATTCAC ACTAGACTAG CTGAGTAACA GGTATCTGAT AGTCGGTGAA CTCGACTACT GGCATTCTCT CATGTTTTTT TTTTTTAGAA TCTGTGTACA TACATATGTA TTTGAGCGAG TTCTGTGCCT CTATTTGTGG GTGGTCGCTT ATGCCAAGAA ATTTTAATTC TTCTTATAGT CTCTTGGCAA CGCGCCCTTA ACGCTTTTTA TGCGTTTTCC GACGTAACGT GTGTGTATCC TTGTTTGCTC ATTAAAAGTT GGGGAAAAAG GTTTACCACC TTCAGAGTTC TTTGTTTTCT GTCTGGTTTT TATTTTCTTT TTTTTGGGTT TTTAAATTTT TCTGCTTTTC CGGTTTTTAT AAGCAGGGTG CTTCAATCAC TAATGAAATT CCGATCGCAA ACATTTCTTC AAAAGATTAT AATAATTGTT GCATTCTTAT CGATTTATGA AAGATTTTGC ATTTTGGATA ACTTAAAATA TACTCAAACA GTGGTAATTG TTTTTTAAAA CAAAAATTAG GTACACGTTA AGCGTGATAT AATAGTGTGT TAATGTCATT TCTTATATCT TCTTATATCT TGACAGATAT ATTTTCTATC GCCCGCCATT GTGGAAATC