Vienna Tile Information
VT ID VT044966
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203571
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 244966
Nearest Genes
Gene Nr FlyBase ID Distance
CG31191 FBgn0051191 10643 bp
Sequence Length 2334
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGCTAATGACTTCTAAATGGCTTGTGA
Right Primer CCGAGACCAGCTCAACTATGCGAAA
Template genomic
Sequence TGCTAATGAC TTCTAAATGG CTTGTGAAAT CGAAAAAAAA ATATTTGTCA TCATAAAATC TAGTGAGCTA AAGCTTCAGT ATATAATCCA ATGTAAAATC AATAATTATC AATTTGAAAA CACTTAAGAT AATTATTTTA TGATTGGGAC TTCATAACTA TATTTAAAGT TTATCTAAAA GTTTAGAAAA TGTACAATAC AAACTTTGAA TAGCTTAAAA TAGGGTACAT AAAAGTATTG ATTTTAATGT ATGGAAACCT TAGTGTTGAA CCTGTCACTT TGTTTGATAT ATGTTTTCAA TGAAAATGCG GAATGGAACT GCACTAGATC GGTTTTCAGG CACAAGCTCC TTTTCGTCCT GCAGATGTTG CGTGTAATCG GCCTCCATGT GAATTACCAT AACACGACAC CAGAAAAGAA CACAAAAAGC AGCATACACA CAGATACGCC ACACAGATAT GCACACAGAC ACACACACAC ACACGTGCCC AGGGATATCC GTGTGCCAGT TCGAATGAAT CTCAGTTCGC ACTTGGCCAA CTGAAGCGTA GACAAGCAGC TCTTTAAGTT TAAGCTAGAC TTCTGCCCCG CCACCCGTTT GTTAAAGGAA CGGATTAAGG CGTCAAAATG TTAGACAAGT TCCTGGCCCG ACTCTGCTCC TGATTCGCCC GTGGATAGAT CAAAGTCCCG CGCTGCATAT ACATATATAT ATCCAATAGA TGAATACATA CACACTGCGA TGTATGGAAG GTCCTTCTGC GTACGTGTGT GTCTGTGTCT GTGTGTGTGT TGTGAACTGC GACGTGGCTT AAGCCCACAG CCCTGACAAT GCCTTTTAAT CAATTCCCCA AGTCGGTCCA TCAATAAGCG ACGGCGAAGG GCCCGGAAAA TGCGAGTTTC CTTTCCGGCT GCCTGCGCGT GCTTTCCTTT TATTTCTGCC ATTCGGCATT TTTCTTGTTG TTTGCCCGGC ATATGTATGT CAATTTTTCT AATGAGCTAG CAAAAATAAG TAAAGTTAGG GCCTTTTCTG CATTTCGATT TAAAGCTCTT TGAAGAATTC TCATTTTATT CTCTCGATTG AAATATTATT TTCTTTTTTT CGCTGGGGAC ATCAAAGTAT TTTAATCAAA TTCAATACAC AAATGGTTCA ATCTGATCAA ATTTATTTTA AGATATTTCT AATATAATTT AATAAATTCT TGGCAACAAG TTAGCTTATG AATGAAAGTG AAATTAATTT CACTTGCCAT ATGGATTTCT TTGGAGATAA ACCCATGAAA CAAATATATA AGATTGTGCT ACATTATTTT TAACAATTTC TGCATTTAAT CTTTCACTTA ATAGGTGACT TAAATTAAGC TTTAAAATTG AGTCACTACA ATATTCTATA AATATAAAAA TATTAGTGTG GGCTATCTCT GCTATTTGAA TATGTGCGTA ATTAGCTAAT ATCCATTTCA TATTAGCTTT TTATAAAATA AATACATTGT GGAATATAGT TGGCTCTCAT AAATGATTAT TAATTTTAAT TTTCAGTATT CATTTATTTA GAAATGTATA ATTAAAACAG ATTATTATAC AAAAAGAGCT GAATATTTAT GAATGACATA TTTCTTGTTT GGAAATTAAT GCTGTTATCT ATGCCTTATT AAATTGTTAG AAAAGAAAAC TTCTACATCA ACGTGTGATA TAAGTTTTAA AGTGGACTAT TAGTATTGCA AAGTTGGAAA TGTGTAATTA ACAGCATTTT CACTTAATTA CTTTAAAGCA GTTTTGAAAT GGCTCTTACC TACGAAGTCC TACGATTGGG TTATGCAATT TTCCTAATGA GTTGGCACAG ATAAACAAAC AAACTCGGAC CCGTGCTTGC ATTTAAGTTT AAAGTCCGTT TAATGCCGAG TGGGGGGGGG GTGTCCCAGT TATGGAGCGC ACTGTACACC TGACTGACCA CACACCACAC CCTCACCCCT CCCTCACACT GACAACCTGA AAGCCAGGTA AACCAGGTTT GTTGCCTGTG CATTAAATTT GATGGCTGCA AGTCCTCAGC TCATAATCAC AAGCAGTCTC CCACCTGCGA AAATGGAATT TAATTTGCTA ATACGCTTCG TTGAGTGGCA AAGGGAGGCG TTTTAGCGGG GTTTCGGGGT TTGAATTGAA GTTAGTCAGG TGAGACAGGT TGACTATGAT GGGTTTTTGG GACTGGCGCT TTTTTGTTGC GCCTGCGGGA GAAATTGTTG AAAATACTTT GCAAATCGTT GCTCCATCCC ATGGCCCAGA CTTTAGTAAT TCTCGGCTGA AAACTTGGCT TTCGCATAGT TGAGCTGGTC TCGG