Vienna Tile Information
VT ID VT040919
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203561
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 240919
Nearest Genes
Gene Nr FlyBase ID Distance
CG8476 FBgn0038127 1810 bp
CG17907 FBgn0000024 34289 bp
Sequence Length 2194
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AACGCCGAGCTGAAGATTTACGACA
Right Primer ACTCGCTTTTATTTCCCGCCCCAAC
Template genomic
Sequence AACGCCGAGC TGAAGATTTA CGACAAGTGG TGACTGGTTG TCTCCGCCGT GCGCTGGCTC ATTTATCTGG CCAATATACA TATGTATATG TGTTACCTAT GCATAGCTAT GTATGTATAT ATAGCGTGCT CCTTTCATCC CGACTTATTA TGACGGGCAA AGAGTTTTTC ATTGGAGCAT CTGATAGCCA GTTTACGAGG GCTTCTTTCG GGGCTCCATG CTGGGTCAAT GGACAGGAAC GTTGCCAAGA AGTCTGCGCC GGCTATGGCT CATCGATTCG ATTCGAGTTC GAGTTCGAGT TGGCTCGACA TCTCGACTTC TCTAATTCTC ATCTTGGTTG GTTTATCGAG TCGCAGCACG GCATACAGCG AAATTTAAAT TATTCATATG TCAGGTTGAA GGCTGCTTTT GCTGCCGCTG CTGCCTTTCG CGTGTAAAAA GCTATTTGAT CGCAAGATTA ACTCCGCTCG GCGATTGTCC GCGGATCAAT TAAAACTAAG TAATGGCGTC TGTGAAACCA GCTAGAAACG GAAATACACA AAACTTCGCA AATAGACAGC GTTTGCATCA ATCAAGTGGA ACAATTTTAT TTGTTTTTCT GGTGAATAAG TTAAGCGGGG GAAGTACGAG TTTTAAAGCG TGTGAGGGTG TCCAACACTT TTCCTCTTTC AACATCTTAC AAAACTATTC AGTTTAAAAG TGCCTTTCGA AGCCCTGGAT TCCTAAATTC GTCTTATTCT ACATATTCTG TCTTCTTTAT AGTCTCTCGT TATCAAATTT TTATCACTGG TTTCCGTTTC TTAGCCTAAC TATCCTTCAA TCAGACTTTC CGTTGCTTTC CGAGGAAGTA AAATACAATA CAATGGTGCC CTGATAACTA TTAACATTTT GGTTAGAGGT ATTTAAATAG CACTCCATTT AGCCACTAAT TAGCCAGGTC TTCAGGTAGA CAAACACCGA GGTGGCCACA TGGGTTATGT GCTGCGCAAA TTCTGCAAAA GAAGATACAG AAATAGCATA AACTTTACTA GATAAACCGG GCATAAAGAG ACTTAACGAC TATGTACTCA AATAAAGTAT CCGCCGACTG CAGGTCTAAT TTGCATTTAC AAAGCTGTCG GCTCTTTTGA GTCGCAGTCG CGTTGGCCCT AATGACAATG CATCTTCTTC CTTTGCATAC TCTTTTTAAA AAAAGGTCAT TCAGTTTTCG AAAGTTTTCG ATATTTAAAC CTCTCGTTAC TTCGACAAGT TTCTGGCTTG ATCCAAAAAA CACAAAAAAC TTAATTATCT AGCAGTCTGT GAAGCAATAA AAGGAAGTTT TTTAATATTA TCTACAACAT TTTTGTAGAT TAAATAAGGT TTACATTATA AAAGAAAAAT TTAAATTTGT ATATGTTTAT ATATATTTTT GAAAAGAAAG TTTTCTCTAT CGGACAACGA AAAAAACTAG GCGATATAAA TATAATATTT AAAATTCAAG AATGTAAGAT AATACGAAGG CATCATAACA CCTGCATCAA TAATGTAAAT TATGATAATT CCAAAAAGAA ATATCCACGA CTGTGTAGAT ACACTCACAT GCACAAATGA ATTGGAAGGT GAATATTTTC CTATGATTTC CGAGCAGAGT ATGCGATATT CGTTACCCTC AGAACCAAAA CAAGATAGAC TTTCCACAGT GCGAAGGCTT AGTCTCGGGT CGGGGCCACT TTAACTTTTA CTACGGATGC GAAATGGCGA CCGTAAATGA AGCCCTGAAC CCCGGGCAAA TTGACAAATG TTGGCACGCA AATTAGGGAG ACGGGCGGCG GCACTGTGGT CACCATGGGC TTTTATGGGG CACCTTTCGT TTTAATTTGC CGTGATTAAT TTGCATATTT CGGCCTGCAG TCGGCATGCG GAAGTGGCGG CATAATTGTG GATTTATATG CATCATAAAT TAAGTTTTCT GCACTTGGGC TGGGCGGGCG GTTAAGTACG CGATTTTATT TGGTGTTTAT CATTTCAGTT TTATTGATTT AATGCAAATG CAAAGTGCCG TGTAATTAGC AGCCGCTAAG TCGGAGTGAT AGAGCTGTTG TCTCAGATGA GAGGCGCTTC CTGAAGCCGA TAATGACTTA CTGGAAAAAT ATGGACAAAG GTGCAAATGC CATTGGGAAA TGATCGACGG TTGGGGCGGG AAATAAAAGC GAGT