Vienna Tile Information
VT ID VT037865
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203547
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 237865
Nearest Genes
Gene Nr FlyBase ID Distance
CG10101 FBgn0037501 15958 bp
CG1149 FBgn0015770 19447 bp
Sequence Length 2075
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGCCTTCGTTCGAGTTCCTTTTGCT
Right Primer GCCTTCACCACTCCCTCAACTTCCA
Template genomic
Sequence GGCCTTCGTT CGAGTTCCTT TTGCTGGGGG CCGAGGAGGT TGGGGAATCC CAAAACTGGT CATTCGATGG CCGGGCCAAA CTATTTCCAT TTTGATTGGG CGCCCTGCTG CCAACGGACT TTGATTTCTC TCGATGCCGC TGCAATTGCA GCTTAAGTGT GCAATTTGAT TTGATTTTTG CCCATTTTTT GACAGGTCCT TGAGGCCCGC TGCTCGGCTT CAGTGCCCTC TGCTCGAAAA CCGAAAATGT AGCACCAAAT TGACATTTTG TTTAATATTC TCGAGTGTGT TTTGCGCTGT GTTTTCTGCC CGCCGGGGCA GCTCGTTGTC GTTGCAGGAA GGATGTGTGT AGTGGTGCCG ATTGCGATTG TGTTTGTGTT TGTCCAGGCC CAGGATATGA ATTGCCGGGC GATTGGCGGA GAATTGCACT CGATGTGGGC CACGTGCTCG ATCGGGCCAT GTGCTCCGCC CGGCGGTGCA TTTGGCCTCT CCTGGCTCAG TTTAAGGATA AGTGCTGGCG AAACAGGCAT GTTGTCGTGT TAAATACGGT GCATGTCACG GCATTAACTT TAAGGCCAAT GTTTGTGTAC CATCTGGGTT TATCAATCAT ATTTAACCCC GTACTGTCAA TTAAATGGCG GTGTAACACA TTTGCAGGCA CGATATATAT ATATTTTTTT TTTTTAAAGC TACGAATTCA TCGCTTATAT CATCTCAATT CATCTATCTA AAGCATTTTG GTTACAGTCT GGGAAGGACG TAAATTATTG AATTTAAGGA ACCCATTGCG AGTTAGTCGT CTTTAAATCT TAGGTACAAG CCCAGCAGAT CAGGAACGAA TAATAGGAAG GCAAAATTAA GAGAAGTGGC AGCTGAATTC CTTTGTCGAC CTCAAATCCT CAACTATTTC ATTTCATTTA ATTTGATTTA TTTCCTGTGT TTTTATTCTG TTTTGCTCTT TGCCAGTATG TTGCCCGGCT CCATTTTCGG CTAAAAGGAA TGCAGCTTAG TGGCCACCCA CATTCGGAAG CAGTCCTTCT TCGAGCTCAT AATAAAATCA CGAATCCAAA TTCAGTCCTT GAAACGCCAC GTCCTTGAGC CATAAAGCCT ACTCTGAATA GAGGCGAAAA AGTGCGAAAA TAATTTCCAA GCAAAAGATT AAAGCCATAA ATTTGGGGCA CGGGAACACA TTTGAGCACA GATTTTTCGG TAAGCAGAAA AGGAAATAGA AAGAAGACAT ACAGAATTAA ATTTAATTAC GTATAGCTTA ACAGAGCCGA AAAGAACGTT TTAGGTAATG ATTTATTCTC GAATATTTGT ATTTCAGATA TATAATATAC AGGCACGATC CAGTATGTTT CGACTTATAA CTACCTGTAA AAGAAATCTG ACTTTTGGGA TAATTTCATG CATAACTGAT GCATGACATG GTTATTTCGC TTCTGATGTT GAGCCAGATC AATAATATAT ACACATTGCA TGGTCCCAAA TGTCTGCCAA CGTAGTACGT TGCCAACTTC TGTTTAAATC CAAGATACCC CTTGTCTATA GCCTTGCAGA GGTTATATTA TAAGTTGAAT AATTCTTCAA AATTTCAGAT AAGTCATTAT TACATTGTAA AGTACATTAA ATATTCATAT ACATGCGTAT AAGTACTGTT GATATGCGTT GTTGGCGCAC TGTGTTTCCT TTTCATATCA ACACCAAATA AATTAACCTT AAATCGCACG CAAACCTGTT TCCACAGCGA AAAGTTTTCA ATGCTTTCTT TGTGGGTTTC CTTCGGAATT ATTGGGGATA AAATCAATGC CATCAAGCCG ACTCACAGAC CCACCCAACC ACACATTAAC AACTGACTTT TGGGCCGCTT AATATCATCA CGCATACGCC CGGTATGTAC ACACGAACAG TTCCGCCAGC TCTGCAATCT TTTGAAAAGG TTTTCGGTTA AAAAATTTTA CATATTTTTA ACGCACAAAG TATGTTGAAT GCAGAGCCTG GAGGCAGTGA GTTCTTCAAA GATGCTTTAC AGTAGTTGGG GAGGTGGATC TGGAAGTTGA GGGAGTGGTG AAGGC