Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT029052
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203522
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 229052
Nearest Genes
Gene Nr FlyBase ID Distance
CG6185 FBgn0036150 7113 bp
CG7590 FBgn0041094 7161 bp
Sequence Length 2100
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AGGCGACGGAACGACCTCCA
Right Primer CACCTGTCATGTGAGACCTGCAACA
Template genomic
Sequence AGGCGACGGA ACGACCTCCA TGGCGAACCG ATTCCAAGTT ATAGGCTAAC AAAGGTTGTA GTACCGCTAG TTTATAGAAT CGGCGTTATA TAATGATCGC ATTTCATCAT CATAGTATTT CTTCTAGAAT TGAACGTTAC TAGCGAATTC GCTGCAGTTG ATTATACATA TATTACCATA CAAAAGTTTA GTAATGCATT TTTCTCTTTC GTAACGCTTT GGGGAGTTAA GGAAAAAAAA AAGAGAAGGA CCATTCATCT ATTAGCGATC CTATCTGACT TCTTCCAGCA CCCATCTATT CCAGCCGAGT ACCTTGTGAT CGATGTCAAA ACATCGGCGA CCTCAGCGAG AATCGTGTGA CAGCGGGAGA TTTTTGGGAA AACCAAACCA TTAACTCATT GTGGAAAATT TGAGGATAAT TTCGAGGCAC CCGGATCTCG ACACAGGTAT AGAACGGATA CTCGACGAGG GCTAGAAAAA CCAGAACCTG ATGATCGAGC TAGCTCCTTG CATCAGGTAG AATTGATGCG ACTGAAAGGA CGATAGCCAA GGGACAGGCG ACACTTTGGA CTGATGAAAT CATTTAGGAA TATATAGAAA TCATTTGGAA ATCTTTAAAA ATGTCTGGTC GTCTGGAAGC ATTACCATTT CGCTACGCTC TGCATAAATT ACGTTCATCG AAAGTTCCAG CCGAGCGACA CTCGATACGA GTACGAGTTT CGATTGCTAT TTGTTGTTAT GCTAAATCTA TTCAGTTCTT AATTTAATTG ATTTAGTGCG ACTTGACCCG GGAAGCGGAT TGCAGCATGG TCTATTTTTG GTTATTTGTC CAAAAACCAA CTTCTAACCT CGACAAAGTC GGATTGCTTG AGCTCTCCCT ACACTTGAAG AAACATAGTT ACCAAATAGG ATTAAAATAT TATGTTTACA GGTTTTTTTT TCTTATAGTC GCTCTATTTT CTCAAATTTT CCTAGCATGT CTAAGCATTA TTTCCCTCAT GTATTGCAAG AAGGATAAGG ACTTAGAGTT CAGGACTAAA ACTCAGACAC AGCCAACTTT TGACCTTCGT AGCACACGCA ATTTCAGGGG TGATTAGCGC TCAGATGTTG GGCACATGGC ACCTACCCCC TCCCGAGTTT CCCATACACA TTTCCCGTTC GTTTCCTATA TTCCTCTATA TATTCCATAA CCCATACCCA TTCCCATTGC GAGTCGAGAG TTGATTCCAC GGCTAGACGA AAGGGGCTGG GTCAGAGTTG AGTGCTAAAT TGATAAATTG CCTTGATTGG AAAGGAAGTT GTGAGTTGCT TGGGGTTGTA TTGTTTTCCC CTTGTTTTCC TGCTCTACGG CTCCGTTTTA TGGTGTCCAT TTCCCATAGA GCTCCAGCTG GGATGTGGCC ATTAAAGAGT ACGAGTTGAG TCGAGTCCGA GTCCGAGTCC GAGGAGTCGC ATCCCTAATT GTAAAAGAGG GGGGAGGAAG CTAACCCATC GTTTCCTCAA TCTCTGTTTA TAATCAACTT GAACTTGGAA GGTTACACGT CAGTGGTTTC TCTACCATGA GTTTATAATC CTATTTGTTG CTTCCAGACG CTCTAATAAG TTGTCATCTA TGTACATATG TACATACATA CATATGTCTT ATGGTGGTTC GTTATTATAT GTGTTATTTC CTCACTGACA TTAGTCACCT TTTTCGTTAT CAAAATCGAT CATACGAGAC TGCTTTAACC AGTCTTCTTT GTTAAAGTTT CTTCTTTTTT TTTTTATTGG GCAATAAAAA AAGACACACT CATTGATTTA AAATTTGATT TGGGCTAGTC ACTTCATATA TGTAAGATTG AATTTAATAT TGATAAGCAA GCAAGTATTT ACTAATATCT CTTATTGGCA TTTCAGTGCG CTCTCTTTGC TGCACAATAA TCACAATACA TTGAAATGGG CTAACGATTT GCATAATGGG ATGATGATGA TGATGATGAG GGCGGTCATC AAATTTCCAG CTGGATCTTG ACATTGTTGA TGGAATCAGC CATGGCACTC TGATAATATA AACTGCCGCT CTTTATCTGC TCCATTGTTG CAGGTCTCAC ATGACAGGTG