Vienna Tile Information
VT ID VT026023
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203515
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 226023
Nearest Genes
Gene Nr FlyBase ID Distance
CG34391 FBgn0085420 10855 bp
CG10633 FBgn0035604 35816 bp
Sequence Length 2143
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer TCCAATGCCAATGAATGCCAACAG
Right Primer CGTTGTTTCCAAGCGCAGACAAAAT
Template genomic
Sequence TCCAATGCCA ATGAATGCCA ACAGCAGTCA GAATGAAGTA CACACCCCGG CATTAGCCGC TCTCGATTTA TGACCCCCAC TTGACCATCC TGACCAGTCA CTCTCCATGT CCACCATGTC CTCCATGTGC TCCTCTGTTC TACATTTCCC CGATTTCCAC CGATTTCCCC TTGAAATGTT TGCATTGGCG AGTCCTTCGT CCGCAGCTCG CCAGCTGAAT CATCCTCAAT CGTCCTCCTC CTGTGCGGCA GTGCATTTTG GACATGTAAT GAGCCGCAGC GGGTCTTGAA CTTTGAATAG GCCCGCTACA TCATCTCTTC CAGTCAATGC AGATTCAGAA TTTCTGAACG AGGTCCTGCA ATTGACATTT ATCGCTGCTG GCTGAGCACC AGACAATGTT GAGGGTTAAG GTAGTCGAAA GGGGTTAAAT GGGTGGGCGG ACTCTTTCGG GGAACTTAAC AACTCATTAA CACGCGCAGG ACAACAATTG CTGTCACTGC CATTGGCAAT TGAAGCGCTT AAACGTTGTA ATTCACTTGT ATCGCACAAT TATTCGCTCA TTTGTTGGAT AACGAAAACC GGATAAAGGT AAAGGTACGA CCCATGTCAG GAAAATGTAA TCGGAAAGGG GGGATTGTAC TCCATACAAT GAGCGAGGCG GTCATAATCC TCCAGGAAAG CCAGATGGAT GCTCTATTGT CTTGGCCATC AAAAGAATTC AGATAGGAAT ATACCAGATT TTTAAAGTCA TTAGAAACTG TTTGACCTCT TCTTTAAATA AATTACGCAA ATTGGACGTG ACACAGATTA AAGCATTGGA AAGATTTAGA AACAATGGGT ATCTTAAAGA TTTCCCATAA AGTTCTCTTA GACCCTGAAG TCCAAAAATT TCCTGTAAGG TCAGGTCACA ATTTCTGTCC CTTGTCATTC TTCTGCCTCC AAAGATCCAC ATGTGCACTT TGCGTTTGCT CCAGGACAAC CCAATCCATC CTGACACGCC TCCAGTTGGG TTCCATCTCA GCATCTCACT CCAACTGGCC ATCTCTCATC CGACCTCGAC AATTTTTGAA TAACTAATGA AGGTGCCAGT TAAACGAGGA ACGAGGAGCA CCAGCAGGAT GGCCACAATA AAACAATAAC AGGCAAAACA CGAGGAATGC GTCGTCGTTG AGGGTCGAGT GCCTAGAAGT CCTGGCCTGA ATATGAAATT CGGATTCCGA TTTCATCCGA CTGTCGACAT TCATCTTGCC AACTGTCTGT CTGGCATTAG GAGTCGAGCG TCCTGTGTCC GCCGTCCAGG ACTTATGCAT CATTGTCAAA ATATTAACAG CTGGCACATT CCCCTTCCCG CCCCTCGTGT GAGCACTTGA GCTCAGATGA TGATGAAATA TATAAATGGA ATTTAAGTTT TTGGGATACA TTTTCCCGGC AAACAGACGA ATGGGTCAAA TCCTTTCTAA ATCGGACTCG CTTTCGCCTG AAAAGCATCA AGAAGTTTGC CTTCCTTTAA CCTCTGACTC AGTCCAGCAT CTGGAGTGCA TAAATCTAGT GCCTGAAAAG GATATTTACG CATTTGCATG GGCATGTGTA AAGATGCTTA GCTGAGGGCA TAAATAATAA GAGATATTTA TAAATCAACA CTGGGAGGAT TTGTACATAA GAACTCTCTC ATATCCAAGG AAACTCATTA GAACAGGAAA AGGGATGGAG GGAAATTGGC ACTTCCTACG AAATAGAAAC CAAGGATATA TACTCTTCTT CTGATTTCTG AAATGATTCG AGTGCAGTGC AGTGGCAAGA CTCCATCCGA ATATCGATTT CCATCAATGG AGTGCATCAG ACAGGAGTTG AGGGGATTTA ATGGGTGCCA TCGAAAAGGG CACCGAATGA CTTTCGTCTG GCTGCTCATG TGGGATGGGG AGTGAGATGG GCATTGCTAA ACAAATTTGC ACTCGAGTAA ATTAAAAACA AACAACAAAA TCAAATATTA ATGTTCTGTA ACGCGTTTCA ACGATATTCA ATCGGATCAG TAGCAGTATA GAGAGTTGCA AACAGGAAAA AGTGCAGAGC AAACACACCA ATTTAGAAAA ATTCAGAACT TTGGTTCAGT TTGTTTGTAT TTTGTCTGCG CTTGGAAACA ACG