Vienna Tile Information
VT ID VT020732
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203509
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 220732
Nearest Genes
Gene Nr FlyBase ID Distance
CG5799 FBgn0020307 21177 bp
Sequence Length 2172
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer GTTTTGTTGTGCACATTTTCGAATGC
Right Primer GCGCTCAAAGTTAATGCTGGTGATTT
Template genomic
Sequence GTTTTGTTGT GCACATTTTC GAATGCGAGT GTGTGTGTGT GTGTGTGCGT GTTTATTGCG CCTAAGCTGC TCAGCGACGC AACACGATAT TTATCCTGCC GCACCTCCCA CCGCCCACAC GGCAGCTGGG CTTTTCCATT TCGGGGCTAT TTTTATGCTC CTGTTTTCGG GATTCTCGGC TGTCTCTGCT GCGTTTCGAT TTATGCAGAG TTTAGTATGC AACATTTTCA TACGTTAGCC TTAATAAATC CCCACCCGGC TGCACTTGTC AATATGCACG ACGTGCCACC ATCCACCGCC CACCGCCCAC CAGTTCCCCA ACCCCCTTGG TCCTGCAGTT GCCACACTGT TGGCACCTAT AAGCCTATGC AAACACATAC ACCCATGCAG GCGGCGCGTT CTGCAATTGA AAATCACTGC GCCTTAGTTA ACGACACGTT TGTGGATCAA CGCATTCGGG AAAACGAACC CCACCCACTT GACCCTGCTA TTGAATCATT GTTGCATTTG GCCACCAAAA GTGGAGCACC AGCGGCAGCA GGAGCTGCAT CCCGCATCCG CATATGCATG TGTCATAAGC CAGGCGGCAC CATGCATACA GGACTATGAG CGTCCTGTGG ACATAAGCAC GCGCTCAAGG ATTCAAAAAA TGGGCACCCA TTCGATCGGC TATTATGCAG ATGTCATGAG GCGGGATTGT ATAATGAGAT GGTGGACTCT AGCCTGTGGG CTGGACGGAA GAGCACCCGA TAAGCCCTGA TGGACACACA AGTGTCGGCA AAGCCGGTCA GTAACTTTGC AGAGCATATT GCTCGAGCTT CGGCTTCAGT TCCAGCTCCA TTTCCATCTC CAGCTCCACT TACTTGGTTT CCGAGTGCTA CTGGTAATCA GGCGACACAA AAGCATTGCA TAGCTCCTGC TGCAGGATAA GAGATACTGT ACTCAACTCA AAGCGGTAGT AGGAGCAGCC GGTTTCGCAA TCACACGCAA AACTAGCTAC GACTCCTCAT TCACCCGAAT CGTCTGACTC TCACCTGTGA GAGGAGTGGC TAAGCCCTGG GCCGATGGAT CCGCTGGGGC GACTGGGGGC GGTGGGCGGT GGTTGAGCGG TAGGAGCTTA AGTGTTAAGC GTTATGCACA GTGGCCAGTG CGAAGCTGAA TGATACCACT CACCTAAGCC GGTTCCCGAA AACCCACTGC CCACTCTCAC TACCAATCTC AAATCCCCCA ATCACCTATC TAAAGCCCAA GCCCCATTCG AGCATATGTG CTAGCGCATA GAGCATAGAT GCAGATGCGG ATACAGATAC AGCCTTAGAT TGAGATACAA ATTCGAATAA ATGCCAAACG CAACAGGAGG CAACGTTTCC AAATTATAAG CAAAAAGGGA TTGGCCCGTG CGGCAGCAGC AGCAACAACA ACAACAACAA CTACTGCAGA ATAAAAGCCG GTTGTTGCCA ACCAGCCACA CATAAACACA CACATACACT CACACACATT GGAATACATT TAGCCAGGAC ATCGCCAGGA GCTAAAGGCA GGTGCTGCAG GTGATGCTGA TTGAGTTAAG CCACCATCAT CGAGTGCACT GCAAAATGCA GAGAGTTTAT CTAAGAGATA CATTTAACAT GGAGATAGAT ACACCAAAAC GAAATGGAAT CGATTACAGT TCTAGAAGAC AATAATTAAG CAACAATAAA TTTTAATAAA ATAATAATAA ATTAAATTCT AAGGCACAGA GAGATATTTT TTTTTTCGTA TAATGCGCTC GAAGATTTTC TGCTGCTCCA GCTTCAGTTA GTCCCTTTAT CCCTCACACA AAGAGAACTA CAAATTTTAA GGATTTAAAT GTTGGTAGAG GTGAACGAAT CGAGCTCTCG AAGCTGCCAC CACAACGGGC CCGGATGAGC CCGAGCGCCC ACCATCCACT TCCCACCGGC AACGTGCAAC TTGCAACTTG CAACCGGCAA CGTGCAACGT CAGTGGAGCA GCTTGAAGCT CGATTCGAGC CGCTTAAGGC TCCCTGTGTG TTTTCGGTTT ATAATCGAAT ATATACTCCC TGTGTGCCGT GTGATTATCA AAACAGAAGT ACGTATTATA CAGCAGCCAC AGCAGCAGTG GCAGTGGCAG CAGGAACTGC AAGTATAAAT CACCAGCATT AACTTTGAGC GC