Vienna Tile Information
VT ID VT063702
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203499
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 263702
Nearest Genes
Gene Nr FlyBase ID Distance
CG33542 FBgn0053542 7206 bp
CG5993 FBgn0004956 22352 bp
Sequence Length 2200
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCCACAAGCTATATATCTCCCCCGA
Right Primer TTACTGGACACTGGACACACGCCC
Template genomic
Sequence GCCACAAGCT ATATATCTCC CCCGACTATA TTTACACACT GATATATGTA TGTACGATTT ACACCTCTAT GTAACTTAGC TTTGATTAGG AATTAACATT TTAGACATCA AATACAAACA CAAATATACA AATATACAAA TACAAACCAT TGAAAGTACA AATGCATCGA GAGTTTATCT GCGGATTGGG TGGTCCTCTC CTGGCGCCAT ATCAATTACA CTCATGTGTG GGGGTATAGT ATATACGAGA TATATTCCCA CCGAAATTGC GCATACGCAC CGTGCTGGAT GAGATGTAAG AGAGACATAA AAGTGTCCAA ACAATTCCCC TTTACGATCG TCGCCGTGGC TTTAATTGCA GCAGAATTAC GCGGCATTTA TAGACTTGTT CAAATATTTT ATGAGCCATA TAATAATTCT CTCCCCTGGG TTTTGGGTTT GGGTTTTTGG CTTGGGTCGG GATCGGGATC GGGATCGGAA TCGGAATCGA GGTCGTAGTC GTAGTCGGAG TTGGAGTCGG GGTCACCTTT GTCCCTTTTT GTCAGCTGCA CACAAAACAC CAGCGATTTA ACGACAAGAA ATGTTTGTCG CCGCTCTTGA TTCACCATTC TCCATTCTCC ATTCCCCGTT CCCGAATCTC CCTTCTCGGC TCTTCCTTTC ACAGATCTCC AATTCTCCCG GCCTTATCGC TGGGCCGGAA TCTACGCGCG CACCTTCACT GAGCCCTGGA TTTTTGATGT TCTCCACTGC GGTTTGCCGG AGTACCCGAA TCGGGTTTAT CGCACACAAT CAGCAATTGT CATTAATTTC GGACTCGGTG TACGTGCTCC GATTTGTCTG CCCAGCACAG CTCCTCCATC TCCAACTGCA TCAGCTACTC CTACTCCGAC TCCTTCTCGG TGACTGATTC AACAATTTAA TATGCCAAAG ATAGAGCGAC AGAGAGGGAT GCATTCCCAT TCTCCATCGC CATCTCCATC TCTGTCTGCG TCTCCAGTAA AGATGGTTAT CGGTCTGATT TTATTGTGTG CTCTCCCTGC GGCAGCCTCT CCGTCGTCCG CTGATCTGGC GAAGATCTGT GGCCAGTGAT CTTGGCCAGG TCCGAGATCC ATCCGAATGA GGCGCACATG CAACTATGCG ATCCCATTCA TGGCCATCCG CCGATAGCTC CCTCTCCCTC TGGCTGCTTT GCATGCAGGC TGCGTCAACC CTTTTGTCCC TTTCAGGTGC ACGTAGCGCA CATCTATCTT CAGTTTTGAT AGGTTTTTAT TGGCCTGACC TTTATTAAAT TGAAAATTAT GTCTTTCTAT GAGAAATGTT GAAATGCCTT CACCCCTCTC ACTCGATCTG TCTCTCTCTC TTTTTCGCTC CCTCTCTTTC CCTCTCCGGA AACCCCTTGT TTTTCGGGGC ATATGCATTA TGGTGCGTAT TGTGGGAACA AAGGTATCAA GGGTTGAGTA CTTATAGAAA TTAGTGGCTT GTTTTATGGT ATTTTGGTGC TTTTAATGAC CGAACCACCG AGAAAACTAT TAATGATGTC CTTATAAAGG ATAACCATCA AGAATTCCAA ATGCGAATAT AACTTCGTAG ATACTTTATA CAAAACAACT GTATAATCTC AGAAATATTT TATATTTAAA TTCAACGCGA TTCTACTTTT TACATCCCAA ACTTGCTATG TTGTCTTAAG AACTAACATC TCTTCCTTTA ATGGGTATCC GTGCTGTCGA GAGCCAGGCT CCCTTGTTTT TGGGACCTCT CCTCTCCTGG CTCCTGCTGA ATGAACTTTT GCGCCTGCAC AGATCTAATC TAAATGTTCA CTTTGTTTTG TTTCTGTTTT CTGTTCAGTT TTAAATCTCT GGATATTTTG TGTCCAACTT GGCCCGTCAC AAGTCACGTG CAGGGAACTG TTTTTGTTTC AGATTTTTTG TGATCTTGGT CGACAGTGCG ACGGCAATTA ATTTAAAATA TCTTATTTCA TTTGTGTGTT TTTCTTGCTT TTCCCCCTCT TATTTTATAT TTAACTTGTA TTCGCCGTGT GTATTTTTGA GTTATGTTTT CCGCTGCAGA TTTCCTCCGA TAATGGCGTT ACATTTATGT TCCCTAAGTG TTCCCAAGCC TCCAGTGGTT CGGTGGCTCA GCGGCGAAGG GGGCGTGGCG CGAAGACCGC CCACCAGGGC GTGTGTCCAG TGTCCAGTAA