Vienna Tile Information
VT ID VT026018
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203478
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 226018
Nearest Genes
Gene Nr FlyBase ID Distance
CG34391 FBgn0085420 19751 bp
CG10633 FBgn0035604 26905 bp
Sequence Length 2158
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCACGTTATACCGCCTGAAGGTGATT
Right Primer GCAAAAGCAAATAAACCAATCTACTAAGCGA
Template genomic
Sequence TCACGTTATA CCGCCTGAAG GTGATTTGTA TAAAGAAACA ATTCTATTAC ATAGGTATAC AAAATATTTC CCTTGCATCG TAGATTTCAA AGTAGCTTGT GGCTTTAGTT AGTTTTGCTA CCTTTTGATC TGGCTAACGT TCTTCTCTTT TTCATCTTTG TTTCGCTGCG TAACTGGTAC ATTGGTTTTT AAACACATAT TCAACTTTTT AAAGAGCACA TTTCACTCGA GCTGCGTAGA CAGGCTTGGC AGCCTCAATC TTTCTGGCAC TTTGCACATT GAAAAGGCAG CCACCTGAAG AGCATTTTGT CAGCATTTTT GACACACGAG TGTCGGGCAA AGTAAACTAA TGATGACAGC CCGGCAGGAC TCGTAGGATA CACGTCTGCA TAAGTGGGAC ACACTCGGGT GACTTATAGC CAAGATCGCT TGACATAATC TCTGGATTCC ATTTACACAT GTGACCACCT CGAAAACTTT AAATTCCGGA AATAATTCCT GTTCGTAATT CAGGGTTTAA GCCACACCAT TAACTTTATT TGTCTGCCAT GTTCAAGGAC ACTGCTTGGA GTTTCCGTTT AACTAATATG ACAACTGTGT CAACTCTACT TGCTAAGATA AATAAACTTT AATTACGGTT CAATTGAGAT TATATATGAA TTCATCACAC AAATTATTAA CTAATGGTAA AAATATTTGT TTTGTATTTA GGGGTTTAGG TTTAGCTACG CTTTTTAATC AGCAAAATAC CATATGTAGA AATAACCAAT TTTCTCTATA AAATCTCAAT TTAAACCGTA CTAGCACCAC TTCTCATTAT CATTTATGCA CATTGTTATG AACTTTCGAG TATACTGAAA CCCCTTTCCA TACCCGTTTT CCCCGCAGCC AACCGAAAAC CACTTCAAAA TTGTCACTCA TAAAAGTTTT ATGTTGACAA TTACGTATAC GCAGCGTGGA CTCTGATTGT CATTCATTCT AGATTGTCAT TTTATAACTC CATGTTGGTC CATCTCCCAC TCACTCAGCC ATTCTCCAAA TATTGTTGCA GTGTCCATTT GTGAGTGCCA TCGAGAAAAG TTTGTTGTTG CTGTCGTGGA AGCTCATAAC AACTGACAAC TGTGGAAATT AATTCTGCCA CGCCCCCACA TTGCACGCCC ACAGTTTTCC ATCCCAACTG GTCGCCCCCA CCATCACCCT TAAGTTTTGT GCTTGAACTT ATTTGCCGGC TTTTACCTGC AATTAGACGC AATTAAAATC GCAAAATGTA ATTTATTTTA ATTGCTGTTT GAAACAACTT TTTGGCCAAA GCCTCAAATT TGGAACATCG TGGAAGGGGT GCTGATTTCT ACATGTTTAG ATAAAGTTCG CTGAAGTGCT TTCAAAATAA TAAAATTACG CACGCAATTT CGGTTGTGAA TTTGATGAAA TTATAAAGTT TTCCTGGCCA TGACCAGCGG CAAAATGTAC ATCTGGGCGT ATACTCAATA TCAGCTCAAG AAATCAGCAA TGAAAGATTC GAGCTTAGAG CTAATTGAAT CAGTAAAGGG CTAAGTAGTC CACCCAAAGA GGGAGCTTAA GGTTCATAAA AATTAATGCT TGCCTGTGGC CTTGGCTTCA ATGTGGGAAC GTGTGAAAAG CTTGCTTTGG GGGGGCTTAA TCCTTATAGC CACTTGTGGC GTAATTAAGG ACAAAAATCG GGGTTGAGCT CTTCTGTCAA TCTCTTGGGA CCACATTTGA TCAGAAGATA AAATTATATA TGGCTAACAA TTTCACTCAA TTGGGAAGTG ATGGTTGGAA GTGATTTTCC TTCCCACACG TTACTCACAT CCGTTTCGCA TTTCTTTGGA ATTTTCCCAC CATATGTGAG GATGACAACA AAGCGAAGGA AGGAAGTCGT GCTTTCGGGA CATGGGAAAT TTATGTGTTA GGCCTTGTAA TGCGATGCCA AAACAGGCAA CGAAAATCCG TTTAGCTGAC ACGGCAGCCG GGTATTGTGT GCTTCATTGA AGGCTGAGCA AACAGAATCA AGTTCAGTCA AATTGCTTTA CTTTACCGCA GATTTGTAGA GGAAATCGCT GGGAGTATCC CAAAGCAATT TACAATCTTG TCAGCATTTT GGGGCAATCG CTTAGTAGAT TGGTTTATTT GCTTTTGC