Vienna Tile Information
VT ID VT008188
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203456
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 208188
Nearest Genes
Gene Nr FlyBase ID Distance
CG4838 FBgn0028644 15750 bp
Sequence Length 2103
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GAAAGGTTTGTTTTGTTCTTTAATTTTGGGG
Right Primer TGGAATTTTAATTTGCGTTCTCCACTTCCT
Template genomic
Sequence GAAAGGTTTG TTTTGTTCTT TAATTTTGGG GAAATAAACA CCATTTATTT AGGAAGTATT CTTTCAGTGC ACCACAAATT CATATAAGCC CGCACTGAAA CTCCATCATG CACTCCACTT TGCATATCAC ATGAACTTGC ACTTCGGCTT TTTGTTTTTC GTATTTCGGC AAGAGAGCAG GTGGATGCAG GAATTAGGGA TCTGCGATGG GATGGCAGGA GCACGCCATG GAGCACCAAA GGCTAAGGGG CTCTGGTGCT GAGTCGTCTT TGTCTGCCAG ACATTTGCCG TTTACTGTTC TGACATTCCA ACTTGGTTGC AATGCAGGCA GGCGACTGAC GTGCCTTTTG TCAGCATACG ACAATTGCGT GAAATGTGCG GTTGATGTCG GCCAGTTTGT CAGGCCGTCG AGCAGCAGAA GGTAAAAATA TTTTCGTAAT CTGATGGCTA ATGCTGTTGA AGAAAAATGT ATGGACACTG TATTTCTTAT TCTGCAATTG CGAAGAAGAA ATGGAACTTC CAAATGCATA AGCGATTGAA AATATACCAG CTAGTGGTTA AACTAAACAT AATATGCTTA ATGTTAAGCT ACCTCAATCA TATACATTTA AACGAAGCCT TTCCAACTTA TTTCCTTGAA CGCATTTAAT TTGTATAAAT TAATTTAGCG CTTTCAACAA ACCGAGTTCC ATCCAAATTG TTTATCGCAA TTGAAAATTA ATATGCCAGC TCTGTTCTGT AATCCCATAA TGTGTATCAA CTTCAAAGTG GCCTACGCAC GTCATAGCCG GCTGAGCTGC ACTTAAAATG CTTTATTCGA AAAATTGCAT TTAATTTGCA CAATGCAAGT GAAAAAAATT GCCTTAAAAT GCAATTTTAA ACGTACTATT TTTACTATGT GCATACGATG TGATAAAAGA TTATGAAATA TCATCAAAAC GATGTGAAAA ACTGGCTTAA CATATCTTAT ATGTACATAT GCGGTTATAA TATACAAATA TCACATATAA ATGCAACAAA TTTGCGGGCA ACAACCATTG GAGCCACAAC AATGGAGCGC CGAACAAGAT GGTCAATGTA CCCGTAGATT TTTATTCTCT TCTTTTGCAG GGGTATGAAA TATGAGTCAA GTTTTCAATG CATGGCGGAT GCATTCATTA TGCCGTTGAC GAGAAAACCC CCAAATGGTC GGAAGTGAGA GAGGTGGAGT GTGGGAGTGG GACGGGTGTA GTGTGAGTGT GTATGCCGTG TATGCCATTA TAGAGTTTCT TTTGGGTTTT TTGTGTGCAT TTATGACAAA TGCATTGCAC TCACAAAGCT CACACACACA CGCGCGCGCA CTGTCGCAAT CTTTATGATC TCATGCATAT GTATGCGTTT ATAAATGCCA CGATACTGTC GGCGAAAGAG AAAGCTGTAT GTGAAACGGG ATAGCACTGT TTTTTATCCC AAATGGTGGT CACTTTGGGC AACAGGCACT GCCAAAAAAT AGTATATAGC TGAACAAGGT TTTTCCATTT ATTTAAATAT TTAAAAATAT AAAAATACGG AATATTTGTC ATATGACAGG AATATAATCA TGAAAGAAAT GATTGCGATT TGAAAATAAC ATTACACTGC GCTCGGATAA ACGAACATTT CTTACATTAA GGTTGATTGC CAAAAATTAA ATTACCTATT AAGTTTAACA AATACCAACC CGTTCAATAG ACTGGAAATA AGAAATGCAT TGCATACAAG AAGGCCGTGG AAGTATGGGC CTTGCCAAAA AGAGTGATTG GAAAGAGCAG AATGAACTGG GAATGCCAAA AAAGAAAAAA ATCTTTAAAA AAGGTGTTGA GAACGCCAAG TCACGAGATG TGGCAGTTGG CTGAAAGGCG TTTGCTAATT TTCTAAGACA TCAATTCGAG GGGAGCGATG AAAGTACGTG TGACAATGTC TGACCCCCTT TTCCTTGTCA CCCAGCCACG CAGCGTTTTT TGCGCTGATT TTGGCACGCA CACATTTTGC ATACTGATCA GCAATCAGTG GCAACAATTC TTCCAACTTT CTAGAGAGAG CCTGAGGCCA ACTAGGAAGT GGAGAACGCA AATTAAAATT CCA