Vienna Tile Information
VT ID VT028327
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203398
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 228327
Nearest Genes
Gene Nr FlyBase ID Distance
CG34356 FBgn0085385 18651 bp
CG8104 FBgn0036059 23117 bp
Sequence Length 2153
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GATATTTTCATTTGGTCGTGGCGGC
Right Primer CAACTTCTACGGCAACGGCATTCATC
Template genomic
Sequence GATATTTTCA TTTGGTCGTG GCGGCGGAAA AAAGTTAAAA TTATGATACC GGAGAGGTAC GCCATAAGGT TAGCTTAAGC CGATTAACGA AAATTGAATT TTCAATTTGG CATTGATTGG TAAGGTAAGG TAAGGTAAGG TAAAGTAACA AAAAAAATAG GGTACCTCTT CACTCCTTTT TTAAGTCCTT TTGCGAAAAC AAAAGTTGTT AAAGTAATCA GGCTAAGTGG CTTTATATAT ATTGATTGAG CTGGGCTTCG ATTAAATTGT AGAACAACCG CAAATCCTTT TAAGATCAAG GTCGATTTAG TTGCTGTCTT GATTTTAAGT TTGAATTAAA TGAGATTGGG CTTAGAAAAA TTAAATGATT ATCTTTGTTT GATTTTCATC TTATTTACAT TAATATATGG CTATGCAGTT TTTCTTACTT CTCAGTCAAG CTAAGAAAAA AAACTAAGAA AAAAATACGT ATGCAAATCA GAACCCTACA ATAATATGGC ATTTCTCAGA AAGGATTTTA ACGCCCAGAC AAAACTTTTA CAATTTCCCG ACTTCACCTT TGACCCACCC AGCCCAACAA CCATTCAATA GAATTCTAGC CTTATTTGCT GAGCTCCAGG TTCGTGTTTA GTTTGGTTTT TAGTTTTAAA ATAAGAGCGA AAGCGAAACT TTTGTGCCGC AAATACTTTG ACAACTTTGC TGACCGCCGT AAGAAGCTGA CAAGCTGGCC GGGAAAATCC GAGAGCGGTC GCCGGTCGGG GAAATTGTCA ATTTGCTTTA TCGCCTTAGA GGAACTGAAG CCACAAATTT ATATGTATAG TATTTATTTG CGGGTTTTCT TTGCACGTGG TCGCATTTCT CCATTTTTTT TTGCGTCTGA TTGTCTTATT ATGCGTTATA AATCGCATGA CGACTGTTAA ACTGACTTTG AATGCTATCA AAATCAGAGT GTATGCAAAC GAGCATAAAA AAGCTTTTTA AAAAGTCGCC AAGTCACAAG AATAAGCGCA CACACTCACC GACAAATATG TTTATATAAT TTGGGTATTT TCCCTGTTTT TTGTGCCTCT CCCTTTTTGG CATTCTCTTC CTTCGTGCGT TCACATATAT AAATATTTTT CACATTTTTC CTTTTTTTTT ATAAATCAAA TTAAAAGGTA TCCCATGTGT GTGGGTTGGT GTATTATGAA AATGCCATGA ATTACTGGCG TATAAAAGTC ATCATTAATT TCTCTGTGAC GCTTTTTTGA CAACCATTTT GGAATTTATT CACTCATTCA TGAAGAGGCA TCACAAACAG ACTCCTCTTT TTTTTTTAGA TGGAAGCACA AATTCGCCTA CTTTCGGCGG GGTCTTTTTT TTCAAATAAT AATCGTTGGA TTTTATAGAT CTTACGGTAA CTACTGTTTG TTTTATTTCT AAATCAATAT TTGATGGACT TTATGTTGTG TAAATAACAT ACCAGTAATT AATTTAAACA AATCATTCCA TTGATCTTTA TGAATGAACT GGCAATTGAT CCCATCAATT ACTGGGTAAC TTTAATTCGA CTCTTGCCAC TAATTCATGT CCACTTATTC GTTATTCCTT TTTACGAGTT CATCAAAGTT GTGGTCGGTG CTTAAAGACT TTGGGCCATG TGACAAGGAT AAACAAGGTC ATAAAACAGC GTGGGCATAT AAAAATGCGT CGAAGATTGC CGCAAAACGG CGCACAGATT CGTCCTGCGA GGAAAGCAGC TGCTGTTGCA GTAAAAGCGG TAAAAGCGGT AAAAGCGGTA GCGGTAACAA TGCCTGGAAA CGGTGTCTGG AATTTATTAT GCATACGCCC TGTAGTGCAT ATTTGTAGCG TGATAAAATC AGTTAATAGT CGCATGAATA AAACATCGCT GAAAGCGAAT GGTGAAAACA AAAGCTCCTG CAGCACGAGC AGGTGCAAAT TTCTCGCGGC CAAAAACCGG AAACTCTTCT AAGCCCTATC GGTTTCCGTC AGATCGCTGT GGCTAATAAA AAATTAGCGA AACAACTTCG CCGGCATTCT CATCGCAATC AGTTGACGGC TGAAACTAAT TTACTTGTCA CTTTTAATTA TTGTTTGCCA TTAAGCGAAG CGTAAACCCG CAATGGGGAT GAATGCCGTT GCCGTAGAAG TTG