Vienna Tile Information
VT ID VT041689
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203348
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 241689
Nearest Genes
Gene Nr FlyBase ID Distance
CG7649 FBgn0051314 12211 bp
Sequence Length 2095
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer GGTGGATTAAGCCAAAGAAAGGGGA
Right Primer CACCACCGAACCTGAATGCGAAA
Template genomic
Sequence GGTGGATTAA GCCAAAGAAA GGGGAACGAG ATACCAGAAA AGGTAAATAG TAACCATATG CCATGACTAA CAGCTGTTTG GCCAAAACAA AAGGCAATAA TGCGAAATGA CGGACAAAAA TGCAGGAAAA ACTGGCAACT AGAAAGAGTA AAAACAACAG CAAACAATGA TTATGCTGAT GAAGACTCAA TTCAGGCCAC AAAGCCATTT TGCTATTATC ATTTTGGTCC TATCAGATAC CCTACCTTCT AGGCCAAATT GTTTTCAGAA GCATCAGATA ATCTATCTTA CAATTAAATG TTTGCATAAC ATCAAAATCA GTTTTCTATA TACTTGATCT ACCAATCATC TATATCCAAC TTGCAATGTA AAATTGTAGT TAAAATTTTA TGAAAGTAAA GAGAACTTTT AGTATATACT CAGACCGAAT TGTAGATTAT ATTTTCGATA AGGATTGTAG TTTCTTTTGT CTTAGATTAT TATTTGGGTG TGTTTTCGCT AGCTGACACA AATTCCCAGC TCTCATTCGC CATTAAAATT GCAACAAAAA TGAATGTCTG GCTAAAAATA AATGTCAGAC TAAAGCCAAG GGGCAACTTA AAGAGGCGAT TACCATCTGT TGCGGGTGAC TCACTACTGT GAATAGGGTC GGTAACTTAA GATTCGCTGC CTTTTGCGTG CAGGAAGTGT GCTTCCATGC GATGGCTTAC CTGCAAGAAC AAAAGAAGAA ATTATTATTA AATTAGCATT GCGGAAAAGG ATTAACTGAA AGGGGTACCC AGACTGCGCA CCGCACTTAT TCCCAGTGTC GACCATTATG ATTAATAACC ACTTATTGTG CGGCGCCGCG ACAATCCATC TACAGACAAG ATCCAGCGCG GCTACAACTT TCCCAAGATC TGTCAGTTCA AAATCGAAAC GCACACGCGT TTCAAATAAA TCATACAAGT CAAGATCGCT GCCTCTTTCT CTCTGTTTCA GTCGATTTTT CTTTGCAAAA GTGTGAGAAA AACAAGTTCA CTTCCAATGG GTTGCGTTTG GTTTATGGGC TGGGAGATAC ACAGTATACA TTTCATATCT ATCACATTAA TAATTAATAA ATATTCCCCC AGTTTACTCA TTTCTTTTTC TTATTTTCAG TTTAATATTT TCTACATTTC TTTAAAGGTC ATTCAACAAC TAGCATTCTC GTTTTTTTTT CAGTGCAGCC TCGGCTCCTT GTCACAACAG CAATTAAAGC CCACAACTTG TTGTTGTTTA GCCTCAAGTG AAATCGATAT CATTTATCGC ATAGCGGAAA AGTGGTTTCG GGTGAACATT TTTCGAGTCG AGTTTGGGCG GTCTGTGGGT TTCACATTTG CCATTTTCAC CCCGCGGCTG AAAGCCCCCC GTCTTCACAA ACTTTCTTGC CCACCGACGG CAGACAACTT TTCAAGGTCG TTCGCTTGGT TAAGCTGAAT TTTGCGGTCT CCGATGTAAA GTGCAAAATT TTGCCAATTA ACTTGGCGAA AAGCAACAAA ACAAAAACAT CAACGGAGAA ACAGCAGACA TTTTGTGAAA ATACATGCAT ATATAGGGGG AATATATTCC AGAGATACAG ATATAGATAC AGATAGGGTT GCAAGTAAGA TACACACTCT TGTTTACCCC CGGCCAAAAT TTAAAGAGCC AACAAGTTTT ATAATGGAAG AAATGAGCGG GCTCGAAAAA AAATTAAAGC AAATTTATTT TAATGATATT ATTTACTTTT ATTTTTATTT ACACAAGCTG CATCCAAACT CGACCATGTT TTTTAATAAA AATAACAGCG AAACAGCATT TTGCATCTGT GCTATGTTTA TTTATTTTTC TTTAACTCAT TACCAAAAAC CCATAAAATG GCTATGAATA GAAAAGTGTT GTGCAAAATA CAAATCCAAT TTGGTATCCA TTGTGTTTTT AAACACCTAG ATAGGCAAAT AAATACGTGA ATTCAAATTG TCTTGTGAGT TGGTAAACTT TTATGAGAAG GCAGCTGAAA ATTTGTGAAA TTTGCACTTT ATTTGCATCC ATATGGTCAG TGAGCAAACC AATTTCGCAT TCAGGTTCGG TGGTG